WormBase Tree Display for Variation: WBVar00144275
expand all nodes | collapse all nodes | view schema
WBVar00144275 | Evidence | Paper_evidence | WBPaper00003082 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1745 | |||||||
Other_name | e1745ts | ||||||||
CE51835:p.Trp1094Ter | |||||||||
CE32051:p.Trp1072Ter | |||||||||
F56D1.4d.1:c.3210G>A | |||||||||
F56D1.4e.1:c.3282G>A | |||||||||
F56D1.4a.1:c.3216G>A | |||||||||
F56D1.4b.1:c.3321G>A | |||||||||
CE32052:p.Trp1107Ter | |||||||||
CE26369:p.Trp1070Ter | |||||||||
HGVSg | CHROMOSOME_II:g.5472274G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F56D1 | |||||
Flanking_sequences | tgtgttcatctacaaagcacttgcggaatg | cacatgtatggtgatactgatgaagatgtt | |||||||
Mapping_target | F56D1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003082 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (24) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Genetics | Interpolated_map_position | II | -1.29801 | ||||||
Mapping_data | In_2_point | 4225 | |||||||
In_multi_point | 850 | ||||||||
851 | |||||||||
852 | |||||||||
853 | |||||||||
881 | |||||||||
882 | |||||||||
1384 | |||||||||
1789 | |||||||||
2326 | |||||||||
3137 | |||||||||
In_pos_neg_data | 3803 | ||||||||
7105 | |||||||||
7111 | |||||||||
7118 | |||||||||
7120 | |||||||||
7129 | |||||||||
7133 | |||||||||
Description | Phenotype (7) | ||||||||
Phenotype_not_observed | WBPhenotype:0000195 | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "At 18C, clr-1(e1745) animals are phenotypically wild-type for fluid accumulation and exhibit normal patterns of DTC migration (Fig. 4B)." | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00005809 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 18 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001984 | Paper_evidence | WBPaper00038105 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit any short- or long-range axon migration defects. | Paper_evidence | WBPaper00038105 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001985 | Paper_evidence | WBPaper00038105 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit any short- or long-range axon migration defects. | Paper_evidence | WBPaper00038105 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002469 | Paper_evidence | WBPaper00038487 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The probability and size of response to plate taps decreased with continued taps applied with a 10s interval, similar to the response of N2 animals. | Paper_evidence | WBPaper00038487 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004027 | Paper_evidence | WBPaper00038487 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit an escape response (reversal) similar to N2 animals upon an initial plate tap. | Paper_evidence | WBPaper00038487 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (20) | |||||||||
Method | Substitution_allele |