WormBase Tree Display for Variation: WBVar00144275
expand all nodes | collapse all nodes | view schema
| WBVar00144275 | Evidence | Paper_evidence | WBPaper00003082 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e1745 | |||||||
| Other_name | e1745ts | ||||||||
| CE51835:p.Trp1094Ter | |||||||||
| CE32051:p.Trp1072Ter | |||||||||
| F56D1.4d.1:c.3210G>A | |||||||||
| F56D1.4e.1:c.3282G>A | |||||||||
| F56D1.4a.1:c.3216G>A | |||||||||
| F56D1.4b.1:c.3321G>A | |||||||||
| CE32052:p.Trp1107Ter | |||||||||
| CE26369:p.Trp1070Ter | |||||||||
| HGVSg | CHROMOSOME_II:g.5472274G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F56D1 | |||||
| Flanking_sequences | tgtgttcatctacaaagcacttgcggaatg | cacatgtatggtgatactgatgaagatgtt | |||||||
| Mapping_target | F56D1 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003082 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004453 | ||||||||
| WBStrain00027098 | |||||||||
| WBStrain00027106 | |||||||||
| WBStrain00027116 | |||||||||
| WBStrain00027118 | |||||||||
| WBStrain00027119 | |||||||||
| WBStrain00027123 | |||||||||
| WBStrain00027125 | |||||||||
| WBStrain00027192 | |||||||||
| WBStrain00027210 | |||||||||
| WBStrain00027219 | |||||||||
| WBStrain00027220 | |||||||||
| WBStrain00028761 | |||||||||
| WBStrain00030705 | |||||||||
| WBStrain00030708 | |||||||||
| WBStrain00030718 | |||||||||
| WBStrain00030719 | |||||||||
| WBStrain00030722 | |||||||||
| WBStrain00030723 | |||||||||
| WBStrain00030728 | |||||||||
| WBStrain00030729 | |||||||||
| WBStrain00030732 | |||||||||
| WBStrain00030761 | |||||||||
| WBStrain00030762 | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000548 | |||||||
| Transcript | F56D1.4a.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F56D1.4a.1:c.3216G>A | ||||||||
| HGVSp | CE32051:p.Trp1072Ter | ||||||||
| cDNA_position | 3331 | ||||||||
| CDS_position | 3216 | ||||||||
| Protein_position | 1072 | ||||||||
| Exon_number | 17/20 | ||||||||
| Codon_change | tgG/tgA | ||||||||
| Amino_acid_change | W/* | ||||||||
| F56D1.4e.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F56D1.4e.1:c.3282G>A | ||||||||
| HGVSp | CE51835:p.Trp1094Ter | ||||||||
| cDNA_position | 3282 | ||||||||
| CDS_position | 3282 | ||||||||
| Protein_position | 1094 | ||||||||
| Exon_number | 17/20 | ||||||||
| Codon_change | tgG/tgA | ||||||||
| Amino_acid_change | W/* | ||||||||
| F56D1.4b.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F56D1.4b.1:c.3321G>A | ||||||||
| HGVSp | CE32052:p.Trp1107Ter | ||||||||
| cDNA_position | 3417 | ||||||||
| CDS_position | 3321 | ||||||||
| Protein_position | 1107 | ||||||||
| Exon_number | 18/21 | ||||||||
| Codon_change | tgG/tgA | ||||||||
| Amino_acid_change | W/* | ||||||||
| F56D1.4d.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F56D1.4d.1:c.3210G>A | ||||||||
| HGVSp | CE26369:p.Trp1070Ter | ||||||||
| cDNA_position | 3326 | ||||||||
| CDS_position | 3210 | ||||||||
| Protein_position | 1070 | ||||||||
| Exon_number | 17/20 | ||||||||
| Codon_change | tgG/tgA | ||||||||
| Amino_acid_change | W/* | ||||||||
| Interactor | WBInteraction000051761 | ||||||||
| WBInteraction000500109 | |||||||||
| WBInteraction000500110 | |||||||||
| WBInteraction000500111 | |||||||||
| WBInteraction000500112 | |||||||||
| WBInteraction000500113 | |||||||||
| WBInteraction000500114 | |||||||||
| WBInteraction000500115 | |||||||||
| WBInteraction000500116 | |||||||||
| WBInteraction000500117 | |||||||||
| WBInteraction000500118 | |||||||||
| WBInteraction000500119 | |||||||||
| WBInteraction000500167 | |||||||||
| WBInteraction000500168 | |||||||||
| WBInteraction000500169 | |||||||||
| WBInteraction000500622 | |||||||||
| WBInteraction000500624 | |||||||||
| WBInteraction000500625 | |||||||||
| WBInteraction000500627 | |||||||||
| WBInteraction000500629 | |||||||||
| WBInteraction000500631 | |||||||||
| WBInteraction000500633 | |||||||||
| WBInteraction000500826 | |||||||||
| WBInteraction000500827 | |||||||||
| WBInteraction000500828 | |||||||||
| WBInteraction000500829 | |||||||||
| WBInteraction000500830 | |||||||||
| WBInteraction000500831 | |||||||||
| WBInteraction000519112 | |||||||||
| WBInteraction000519446 | |||||||||
| WBInteraction000519447 | |||||||||
| WBInteraction000519835 | |||||||||
| WBInteraction000538556 | |||||||||
| WBInteraction000538557 | |||||||||
| WBInteraction000538558 | |||||||||
| Genetics | Interpolated_map_position | II | -1.29801 | ||||||
| Mapping_data | In_2_point | 4225 | |||||||
| In_multi_point | 850 | ||||||||
| 851 | |||||||||
| 852 | |||||||||
| 853 | |||||||||
| 881 | |||||||||
| 882 | |||||||||
| 1384 | |||||||||
| 1789 | |||||||||
| 2326 | |||||||||
| 3137 | |||||||||
| In_pos_neg_data | 3803 | ||||||||
| 7105 | |||||||||
| 7111 | |||||||||
| 7118 | |||||||||
| 7120 | |||||||||
| 7129 | |||||||||
| 7133 | |||||||||
| Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Inviable at 25C. Easy to score (ES3) at 25C, difficult to score (ES2) at 20C. | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000195 | Paper_evidence | WBPaper00005809 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "At 18C, clr-1(e1745) animals are phenotypically wild-type for fluid accumulation and exhibit normal patterns of DTC migration (Fig. 4B). However, in double mutants with an unc-5 hypomorph or null allele, a significant increase in the frequency of anterior and/or posterior DTC migration defects was observed (Fig. 4C)." | Paper_evidence | WBPaper00005809 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00005809 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00005809 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Temperature | 18 | Paper_evidence | WBPaper00005809 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Genotype | unc-5(e152) | Paper_evidence | WBPaper00005809 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| unc-5(e53) | Paper_evidence | WBPaper00005809 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| unc-5(ev585) | Paper_evidence | WBPaper00005809 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000426 | Paper_evidence | WBPaper00006119 | |||||||
| Curator_confirmed | WBPerson1754 | ||||||||
| Remark | Induces an increase in di-phosphorylation of MPK-1 at restrictive temperature | Paper_evidence | WBPaper00006119 | ||||||
| Curator_confirmed | WBPerson1754 | ||||||||
| Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00006119 | ||||||
| Curator_confirmed | WBPerson1754 | ||||||||
| WBPhenotype:0000691 | Paper_evidence | WBPaper00005809 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "The severe phenotype of clr-1(e1745) when shifted to the restrictive temperature of 25C, including gonadal rupture, precludes examination of the effects of a strong reduction of function of clr-1 (Fig. 4A)." | Paper_evidence | WBPaper00005809 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00005809 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000882 | Person_evidence | WBPerson33324 | |||||||
| Curator_confirmed | WBPerson33324 | ||||||||
| Remark | PVD branching defect and ectopic branches increase when shifting to the restrictive temperature | Person_evidence | WBPerson33324 | ||||||
| Curator_confirmed | WBPerson33324 | ||||||||
| WBPhenotype:0001010 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | starved translucent appearance at 20C, facilitating Nomarski visualization of neuron processes; phenocopied by growth on 1mM orthovanadate. Inviable at 25C. Suppresses egl-15(n1477ts), and SM Mig defect of egl-17(1313)ES3 (25C) ES2 (20C) | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001645 | Paper_evidence | WBPaper00006119 | |||||||
| Curator_confirmed | WBPerson1754 | ||||||||
| Remark | Induces muscle protein degradation at restrictive temperature | Paper_evidence | WBPaper00006119 | ||||||
| Curator_confirmed | WBPerson1754 | ||||||||
| Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00006119 | ||||||
| Curator_confirmed | WBPerson1754 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000195 | Paper_evidence | WBPaper00005809 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "At 18C, clr-1(e1745) animals are phenotypically wild-type for fluid accumulation and exhibit normal patterns of DTC migration (Fig. 4B)." | Paper_evidence | WBPaper00005809 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00005809 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00005809 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Temperature | 18 | Paper_evidence | WBPaper00005809 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001984 | Paper_evidence | WBPaper00038105 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals do not exhibit any short- or long-range axon migration defects. | Paper_evidence | WBPaper00038105 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001985 | Paper_evidence | WBPaper00038105 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals do not exhibit any short- or long-range axon migration defects. | Paper_evidence | WBPaper00038105 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0002469 | Paper_evidence | WBPaper00038487 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | The probability and size of response to plate taps decreased with continued taps applied with a 10s interval, similar to the response of N2 animals. | Paper_evidence | WBPaper00038487 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0004027 | Paper_evidence | WBPaper00038487 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals exhibit an escape response (reversal) similar to N2 animals upon an initial plate tap. | Paper_evidence | WBPaper00038487 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00003082 | ||||||||
| WBPaper00038105 | |||||||||
| WBPaper00038487 | |||||||||
| WBPaper00015792 | |||||||||
| WBPaper00025979 | |||||||||
| WBPaper00005809 | |||||||||
| WBPaper00013863 | |||||||||
| WBPaper00013925 | |||||||||
| WBPaper00011133 | |||||||||
| WBPaper00011031 | |||||||||
| WBPaper00015702 | |||||||||
| WBPaper00006119 | |||||||||
| WBPaper00023800 | |||||||||
| WBPaper00015779 | |||||||||
| WBPaper00023169 | |||||||||
| WBPaper00023006 | |||||||||
| WBPaper00018266 | |||||||||
| WBPaper00014446 | |||||||||
| WBPaper00014647 | |||||||||
| WBPaper00016818 | |||||||||
| Method | Substitution_allele |
