WormBase Tree Display for Variation: WBVar00145037
expand all nodes | collapse all nodes | view schema
WBVar00145037 | Name | Public_name | e2890 | ||||
---|---|---|---|---|---|---|---|
Other_name | F23H12.4b.1:c.674G>A | ||||||
CE05707:p.Gly291Glu | |||||||
F23H12.4a.1:c.872G>A | |||||||
CE46560:p.Gly225Glu | |||||||
HGVSg | CHROMOSOME_V:g.12354046G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F23H12 | |||
Flanking_sequences | tgtaatatttcaggtattgcgctctcgatg | aggagtcttcttcgaggacggaaccagacg | |||||
Mapping_target | F23H12 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00024637 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00005018 | |||||
Transcript | F23H12.4a.1 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | ||||||
SIFT | 0 | deleterious | |||||
PolyPhen | 0 | unknown | |||||
HGVSc | F23H12.4a.1:c.872G>A | ||||||
HGVSp | CE05707:p.Gly291Glu | ||||||
cDNA_position | 1148 | ||||||
CDS_position | 872 | ||||||
Protein_position | 291 | ||||||
Exon_number | 4/5 | ||||||
Codon_change | gGa/gAa | ||||||
Amino_acid_change | G/E | ||||||
F23H12.4b.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | ||||||
SIFT | 0 | deleterious | |||||
PolyPhen | 0 | unknown | |||||
HGVSc | F23H12.4b.1:c.674G>A | ||||||
HGVSp | CE46560:p.Gly225Glu | ||||||
cDNA_position | 674 | ||||||
CDS_position | 674 | ||||||
Protein_position | 225 | ||||||
Exon_number | 2/2 | ||||||
Codon_change | gGa/gAa | ||||||
Amino_acid_change | G/E | ||||||
Isolation | Mutagen | ENU | Paper_evidence | WBPaper00024637 | |||
Genetics | Interpolated_map_position | V | 4.00901 | ||||
Remark | This allele has the same nucleotide mutation (and hence the same amino acid change) at the same position as sc8, but was mutated by the a different mutagen. | Paper_evidence | WBPaper00024637 | ||||
Method | Substitution_allele |