WormBase Tree Display for Variation: WBVar00145037
expand all nodes | collapse all nodes | view schema
| WBVar00145037 | Name (3) | ||||||
|---|---|---|---|---|---|---|---|
| Sequence_details | SMap | S_parent | Sequence | F23H12 | |||
| Flanking_sequences | tgtaatatttcaggtattgcgctctcgatg | aggagtcttcttcgaggacggaaccagacg | |||||
| Mapping_target | F23H12 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00024637 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00005018 | |||||
| Transcript | F23H12.4a.1 (12) | ||||||
| F23H12.4b.1 (12) | |||||||
| Isolation | Mutagen | ENU | Paper_evidence | WBPaper00024637 | |||
| Genetics | Interpolated_map_position | V | 4.00901 | ||||
| Remark | This allele has the same nucleotide mutation (and hence the same amino acid change) at the same position as sc8, but was mutated by the a different mutagen. | Paper_evidence | WBPaper00024637 | ||||
| Method | Substitution_allele |
