WormBase Tree Display for Variation: WBVar00145193
expand all nodes | collapse all nodes | view schema
| WBVar00145193 | Evidence | Paper_evidence | WBPaper00027624 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | ep273 | |||||||
| Other_name | C16C2.3a.1:c.-61-3014C>T | ||||||||
| C16C2.2b.1:c.472G>A | |||||||||
| CE17404:p.Glu158Lys | |||||||||
| CE30491:p.Glu158Lys | |||||||||
| C16C2.2a.1:c.472G>A | |||||||||
| HGVSg | CHROMOSOME_I:g.9723920G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C16C2 | |||||
| Flanking_sequences | cagtctgagcttcaattgaagcagcaaaaa | aaaaaaagaaagtggacaaggtagtgttcg | |||||||
| Mapping_target | C16C2 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00027624 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004787 | ||||||||
| Laboratory | CE | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00007620 | |||||||
| WBGene00001145 | |||||||||
| Transcript | C16C2.2b.1 (12) | ||||||||
| C16C2.2a.1 (12) | |||||||||
| C16C2.3a.1 | VEP_consequence | intron_variant | |||||||
| VEP_impact | MODIFIER | ||||||||
| HGVSc | C16C2.3a.1:c.-61-3014C>T | ||||||||
| Intron_number | 1/14 | ||||||||
| Interactor | WBInteraction000542427 | ||||||||
| WBInteraction000542431 | |||||||||
| WBInteraction000542435 | |||||||||
| WBInteraction000542439 | |||||||||
| Genetics | Interpolated_map_position | I | 3.8676 | ||||||
| Description | Phenotype | WBPhenotype:0000004 | Paper_evidence | WBPaper00050796 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "We evaluated this question by crossing the grk-2(gk268) and grk-2(rt97) alleles with strains that are constitutive egg layers. These strains include a gain-of-function strain that has activated Gαq (egl-30(ep271)) as well as loss-of-function strains that are defective in Gαo (goa-1(n1134)), the G protein that inhibits egg laying; EAT-16 (eat-16(ep273)), the regulator of G protein signaling (RGS) protein of Gαq; or diacylglycerol kinase (dgk-1(sy428)), a potential effector enzyme that phosphorylates diacylglycerol." (Figure 3A) | Paper_evidence | WBPaper00050796 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00050796 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | GO_term | GO:0018991 | PATO:0002356 | Paper_evidence | WBPaper00050796 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00027624 | ||||||||
| WBPaper00050796 | |||||||||
| Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001145 Missense 158 E to K | Paper_evidence | WBPaper00027624 | ||||||
| Method | Substitution_allele |
