WormBase Tree Display for Variation: WBVar00145348
expand all nodes | collapse all nodes | view schema
WBVar00145348 | Evidence | Paper_evidence | WBPaper00032966 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ft15 | |||||||
Other_name | CE39527:p.Glu116Lys | ||||||||
W10G6.2a.1:c.346G>A | |||||||||
W10G6.2b.1:c.376G>A | |||||||||
CE39528:p.Glu126Lys | |||||||||
W10G6.2a.2:c.346G>A | |||||||||
HGVSg | CHROMOSOME_X:g.16258923C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | W10G6 | |||||
Flanking_sequences | gatgagaataatgttgatctcggaccaagt | agaggaaaacgtatgttttggccataaggat | |||||||
Mapping_target | W10G6 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00032966 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00023654 | ||||||||
WBStrain00023656 | |||||||||
Laboratory | KQ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004789 | |||||||
Transcript | W10G6.2b.1 (12) | ||||||||
W10G6.2a.1 (12) | |||||||||
W10G6.2a.2 (12) | |||||||||
Interactor | WBInteraction000537334 | ||||||||
WBInteraction000537335 | |||||||||
WBInteraction000537360 | |||||||||
WBInteraction000537361 | |||||||||
WBInteraction000537362 | |||||||||
WBInteraction000537371 | |||||||||
Genetics | Interpolated_map_position | X | 23.7003 | ||||||
Description | Phenotype | WBPhenotype:0001171 | Paper_evidence | WBPaper00045812 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table S1 | Paper_evidence | WBPaper00045812 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00045812 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "On the contrary, Phsp-6::gfp, expression was enhanced in the sgk-1(ft15) gain of function mutants (Figure 3), which live shorter (Figure 1B), upon prohibitin depletion." | Paper_evidence | WBPaper00045812 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0034514 | PATO:0000460 | Paper_evidence | WBPaper00045812 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | Phsp-6::gfp; phb-1(RNAi) | Paper_evidence | WBPaper00045812 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000120 | Paper_evidence | WBPaper00045812 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Although we did not observe any significant effect on mitochondrial function using the ATP and mitochondrial membrane potential assays, interestingly, Western Blot analysis revealed that sgk-1(ok538) and rict-1(ft7) mutants have reduced protein levels of PHB-1 (Figure 8). In contrast, daf-2(e1370) and daf-2(e1370); sgk-1(ok538) loss of function mutants did not show any alteration in the PHB-1 protein levels (Figure 8). Likewise, the gain of function of sgk-1(ft15) animals did not show an alteration in the protein content of PHB-1 (Figure 8)." | Paper_evidence | WBPaper00045812 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000231 | Paper_evidence | WBPaper00032966 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | sgk-1 (ft15) mutants displayed wild-type body size | Paper_evidence | WBPaper00032966 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00032966 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00032966 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00032966 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001182 | Paper_evidence | WBPaper00032966 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | sgk-1 (ft15) mutants displayed wild-type fat content | Paper_evidence | WBPaper00032966 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00032966 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00032966 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Nile Red staining | Paper_evidence | WBPaper00032966 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00032966 | ||||||||
WBPaper00045812 | |||||||||
Method | Substitution_allele |