WormBase Tree Display for Variation: WBVar00146522
expand all nodes | collapse all nodes | view schema
WBVar00146522 | Evidence | Paper_evidence | WBPaper00003548 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | B0207 | |||||
Flanking_sequences | TGGTGAATGGAGCCGATCACAGTGACGCAGTTGACTTATG | GCAATCGGCGTTCTCTGCTATGAGTTTCTCGTTGGAAAAC | |||||||
Mapping_target | CHROMOSOME_I | ||||||||
Source_location | 200 | CHROMOSOME_I | 5938303 | 5938303 | |||||
Type_of_mutation | Substitution | G | A | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00023752 | ||||||||
Laboratory | KR | ||||||||
Analysis | WGS_Rose | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000099 | |||||||
Transcript | B0207.4.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0207.4.1:c.630G>A | ||||||||
HGVSp | CE24761:p.Trp210Ter | ||||||||
cDNA_position | 637 | ||||||||
CDS_position | 630 | ||||||||
Protein_position | 210 | ||||||||
Exon_number | 5/7 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
B0207.4.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0207.4.2:c.630G>A | ||||||||
HGVSp | CE24761:p.Trp210Ter | ||||||||
cDNA_position | 711 | ||||||||
CDS_position | 630 | ||||||||
Protein_position | 210 | ||||||||
Exon_number | 6/8 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Genetics | Interpolated_map_position | I | 0.482348 | ||||||
Mapping_data | In_2_point | 5225 | |||||||
5226 | |||||||||
In_pos_neg_data (12) | |||||||||
Description | Phenotype | WBPhenotype:0000062 | Paper_evidence | WBPaper00040589 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000447 | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mutants arrested as adult hermaphrodites | Paper_evidence | WBPaper00002829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive (2) | |||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002829 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dpy-5 unc-13; sDp2 | Paper_evidence | WBPaper00002829 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00003985 | |||||||
WBPaper00002829 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | sterile adult | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
sterile adult mutants had a normal life-span of two to three weeks and grew to the expected size for Unc-13 adults (0.6+/-0.8 mm) | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive (2) | |||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002829 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dpy-5 unc-13; sDp2 | Paper_evidence | WBPaper00002829 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000691 | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mutants failed to develop a normal gonad; DAPI staining revealed a group of nuclei clustered at the vulva but no structure that could be recognized as a gonad was observed; Homozygotes for let-603(h289) lacked gonads. Where the gonads should have been located, there was a mass of undifferentiated, tumor-like tissue. The tissue mass caused these animals to bulge in the center, since the diameter of the animal here was larger than it was anteriorly or posteriorly. DAPI staining revealed a group of nuclei, which might be undifferentiated germ cells. The tissue mass subsequently became necrotic, degenerating into a localized group of nuclei. | Paper_evidence | WBPaper00002829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive (2) | |||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002829 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dpy-5 unc-13; sDp2 | Paper_evidence | WBPaper00002829 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Homozygotes for let-603(h289) lacked a vulva | Paper_evidence | WBPaper00002829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive (2) | |||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002829 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dpy-5 unc-13; sDp2 | Paper_evidence | WBPaper00002829 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001038 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | gonad tumorous mass | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000670 | Paper_evidence | WBPaper00002829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | none of the sterile mutants were rescued by wild-type sperm, thereforenone of them had defects in spermatogenesis alone. | Paper_evidence | WBPaper00002829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive (2) | |||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002829 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dpy-5 unc-13; sDp2 | Paper_evidence | WBPaper00002829 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040589 | ||||||||
WBPaper00003548 | |||||||||
WBPaper00002829 | |||||||||
WBPaper00000975 | |||||||||
WBPaper00003985 | |||||||||
WBPaper00000699 | |||||||||
WBPaper00045317 | |||||||||
Method | Substitution_allele |