WormBase Tree Display for Variation: WBVar00241238
expand all nodes | collapse all nodes | view schema
| WBVar00241238 | Evidence | Paper_evidence | WBPaper00006240 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | qm30 | |||||||
| Other_name | qm30tsmat | ||||||||
| HGVSg | CHROMOSOME_III:g.5278938_5279527del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | ZC395 | |||||
| Flanking_sequences | acaagattacgtgatgaggagcttcatcat | aacttctgatgatgaccagaactttttttc | |||||||
| Mapping_target | ZC395 | ||||||||
| Type_of_mutation | Deletion | ||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00026639 | ||||||||
| WBStrain00026647 | |||||||||
| Laboratory | MQ | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000536 | |||||||
| Transcript | ZC395.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
| VEP_impact | HIGH | ||||||||
| cDNA_position | 454-? | ||||||||
| CDS_position | 454-? | ||||||||
| Protein_position | 152-? | ||||||||
| Intron_number | 4/5 | ||||||||
| Exon_number | 4-6/6 | ||||||||
| Interactor | WBInteraction000500522 | ||||||||
| WBInteraction000500523 | |||||||||
| WBInteraction000500524 | |||||||||
| WBInteraction000500525 | |||||||||
| WBInteraction000500526 | |||||||||
| WBInteraction000500527 | |||||||||
| WBInteraction000500528 | |||||||||
| WBInteraction000500529 | |||||||||
| WBInteraction000500530 | |||||||||
| WBInteraction000517492 | |||||||||
| WBInteraction000518773 | |||||||||
| WBInteraction000520261 | |||||||||
| WBInteraction000520262 | |||||||||
| WBInteraction000520263 | |||||||||
| WBInteraction000520264 | |||||||||
| WBInteraction000520265 | |||||||||
| WBInteraction000520266 | |||||||||
| WBInteraction000520267 | |||||||||
| WBInteraction000520268 | |||||||||
| WBInteraction000520269 | |||||||||
| WBInteraction000520270 | |||||||||
| WBInteraction000520271 | |||||||||
| WBInteraction000520272 | |||||||||
| WBInteraction000520273 | |||||||||
| WBInteraction000520274 | |||||||||
| WBInteraction000520275 | |||||||||
| WBInteraction000520276 | |||||||||
| WBInteraction000520277 | |||||||||
| WBInteraction000520278 | |||||||||
| WBInteraction000520279 | |||||||||
| WBInteraction000520280 | |||||||||
| WBInteraction000520281 | |||||||||
| WBInteraction000520282 | |||||||||
| WBInteraction000520283 | |||||||||
| WBInteraction000520284 | |||||||||
| WBInteraction000520285 | |||||||||
| WBInteraction000520707 | |||||||||
| WBInteraction000520708 | |||||||||
| WBInteraction000520727 | |||||||||
| WBInteraction000525028 | |||||||||
| WBInteraction000534733 | |||||||||
| WBInteraction000534734 | |||||||||
| WBInteraction000534735 | |||||||||
| WBInteraction000534736 | |||||||||
| WBInteraction000534737 | |||||||||
| WBInteraction000534738 | |||||||||
| WBInteraction000534739 | |||||||||
| WBInteraction000534740 | |||||||||
| WBInteraction000534741 | |||||||||
| WBInteraction000534742 | |||||||||
| WBInteraction000534743 | |||||||||
| WBInteraction000534744 | |||||||||
| WBInteraction000534745 | |||||||||
| WBInteraction000535966 | |||||||||
| WBInteraction000535968 | |||||||||
| WBInteraction000535970 | |||||||||
| WBInteraction000535972 | |||||||||
| WBInteraction000535975 | |||||||||
| WBInteraction000535979 | |||||||||
| WBInteraction000535980 | |||||||||
| WBInteraction000535982 | |||||||||
| WBInteraction000537384 | |||||||||
| WBInteraction000537430 | |||||||||
| WBInteraction000537431 | |||||||||
| WBInteraction000537432 | |||||||||
| WBInteraction000537433 | |||||||||
| WBInteraction000537434 | |||||||||
| WBInteraction000537435 | |||||||||
| WBInteraction000541823 | |||||||||
| Genetics | Interpolated_map_position | III | -1.84661 | ||||||
| Description | Phenotype | WBPhenotype:0000031 | Paper_evidence | WBPaper00041212 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "As previously demonstrated, both clk-1(qm30) and isp-1(qm150) worms developed considerably slower than wild-type animals [22,28]." | Paper_evidence | WBPaper00041212 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000042 | Paper_evidence | WBPaper00036073 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00036073 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000061 | Paper_evidence | WBPaper00036073 | |||||||
| WBPaper00038379 | |||||||||
| WBPaper00027157 | |||||||||
| WBPaper00006515 | |||||||||
| WBPaper00046786 | |||||||||
| WBPaper00051094 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPerson2987 | |||||||||
| WBPerson6852 | |||||||||
| Remark | Animals are long-lived. | Paper_evidence | WBPaper00038379 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Mutants are long-lived. | Paper_evidence | WBPaper00027157 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| "Interestingly, the expression of CLK-1-nuc(+) in clk-1 null worms caused a decrease in their enhanced longevity phenotype (Fig. 5a,b and Supplementary Table 1). This infers that nuclear CLK-1 can regulate longevity and that this is unrelated to the mitochondrial role of CLK-1 in ubiquinone biosynthesis." | Paper_evidence | WBPaper00046786 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Rescued_by_transgene | WBTransgene00020965 | ||||||||
| EQ_annotations | GO_term | GO:0007568 | PATO:0000460 | Paper_evidence | WBPaper00046786 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00051094 | |||||
| Curator_confirmed | WBPerson6852 | ||||||||
| WBPhenotype:0000119 | Paper_evidence | WBPaper00036073 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Although SOD-1 levels were unchanged from wild-type levels, SOD-2 levels appeared to be increased. | Paper_evidence | WBPaper00036073 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000136 | Paper_evidence | WBPaper00046786 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "We found that expression of CLK-1-nuc(+) could rescue the increased expression of the closest WWOX homologue, dhs-7, in clk-1 null worms, and that human WWOX expression was increased on loss of nuclear COQ7 (Fig. 4f,g,i and Supplementary Fig. 3a,d)... We found that transcripts of sod-2, encoding a ROS detoxification enzyme, were increased in clk-1 null worms as previously reported. Furthermore, transcripts of skn-1, encoding a transcription factor that is a central regulator of ROS homeostatic gene expression, were also increased (Supplementary Fig. 3b). The expression of nuclear CLK-1 in clk-1 null worms abrogated the increased transcript levels of these genes (Supplementary Fig. 3b)." | Paper_evidence | WBPaper00046786 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| "We subsequently monitored transcript levels for a range of UPRmt genes and identified a subset (hsp-6, hsp-60, spg-7) where increased expression in clk-1 null worms was abrogated by expression of CLK-1-nuc(+) (Fig. 6b and Supplementary Fig. 4a)." | Paper_evidence | WBPaper00046786 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| clk-1(qm30) resulted in increased mRNA levels of ymel-1 and tim-17 (Figure 6b, S4a); "Furthermore, we noted that some of the UPRmt-associated genes that were not regulated by nuclear COQ7 (DNAJA3, ENDOG, PMPCB, tim-17, ymel-1/YME1L1) are downstream targets of a distinct UPRmt instigated in the mitochondrial matrix (Fig. 6b,c and Supplementary Fig. 4a,b)." | Paper_evidence | WBPaper00046786 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Rescued_by_transgene | WBTransgene00020965 | ||||||||
| WBPhenotype:0000137 | Paper_evidence | WBPaper00046786 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "In clk-1 null worms, glna-1 transcript levels were decreased compared with wild-type animals, an effect that was rescued in the presence of CLK-1-nuc(+) (Fig. 4e and Supplementary Fig. 3a)." | Paper_evidence | WBPaper00046786 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Rescued_by_transgene | WBTransgene00020965 | ||||||||
| WBPhenotype:0000154 | Paper_evidence | WBPaper00036073 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000207 | Paper_evidence | WBPaper00036073 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | slow defecation | Paper_evidence | WBPaper00036073 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000208 | Paper_evidence | WBPaper00031896 | |||||||
| WBPaper00051094 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPerson6852 | |||||||||
| Remark | The defecation mean cycle time was increased about 40% above the defecation cycle of wild-type animals. | Paper_evidence | WBPaper00031896 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00051094 | |||||
| Curator_confirmed | WBPerson6852 | ||||||||
| WBPhenotype:0000442 | Paper_evidence | WBPaper00046786 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "The expression of CLK-1-nuc(+) did not rescue the delayed larval development observed in clk-1 null worms (Fig. 5c), which is consistent with this phenotype being due to the loss of mitochondrial CLK-1." | Paper_evidence | WBPaper00046786 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000462 | Paper_evidence | WBPaper00046786 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "CLK-1-nuc(+) was also able to significantly rescue the ROS-sensitivity phenotype of clk-1 null worms when exposed to the mitochondrial respiratory chain inhibitor Paraquat (Fig. 4b)." | Paper_evidence | WBPaper00046786 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Rescued_by_transgene | WBTransgene00020965 | ||||||||
| Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00046786 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | GO_term | GO:0000302 | PATO:0000460 | Paper_evidence | WBPaper00046786 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000463 | Paper_evidence | WBPaper00041750 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | clk-1(qm30) mutants were found to produce several metabolite compounds in significantly altered amounts relative to wild-type worms (Figure 1B, S5). | Paper_evidence | WBPaper00041750 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000641 | Paper_evidence | WBPaper00036073 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Clk mutants had a longer period of mobility than wild-type worms. | Paper_evidence | WBPaper00036073 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000674 | Paper_evidence | WBPaper00036073 | |||||||
| WBPaper00045829 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPerson2987 | |||||||||
| Remark | "Exposure to P. aeruginosa also caused striking developmental delays in combination with mild mitochondrial stresses such as ethidium bromide, paraquat or the clk-1(qm30) allele (Fig. 2b), consistent with the pathogen causingmodest mitochondrial stress." | Paper_evidence | WBPaper00045829 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Life_stage | WBls:0000022 | PATO:0000460 | Paper_evidence | WBPaper00036073 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| GO_term | GO:0034514 | PATO:0000460 | Paper_evidence | WBPaper00045829 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000688 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Worms are viable at 20C but become sterile at 25C. | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000722 | Paper_evidence | WBPaper00055188 | |||||||
| Curator_confirmed | WBPerson21876 | ||||||||
| Remark | Reduced nucleolar size | Paper_evidence | WBPaper00055188 | ||||||
| Curator_confirmed | WBPerson21876 | ||||||||
| WBPhenotype:0001236 | Paper_evidence | WBPaper00041370 | |||||||
| WBPaper00041212 | |||||||||
| WBPaper00046786 | |||||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | clk-1(qm30) mutation induced the mitochondrial unfolded protein response, as indicated by increased expression of hsp-60p::GFP (Figure 3B) | Paper_evidence | WBPaper00041370 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| "We next investigated ATFS-1-dependent hsp-60pr::gfp activation in strains harboring the well-characterized clk-1(qm30) or isp- 1(qm150) mutations [26,27]... As both mutations affect respiration and display impaired development [22,23], we hypothesized that they would cause activation of the UPRmt. Indeed, hsp-60pr::gfp expression was consistently elevated in both strains consistent with the presence of mitochondrial stress. The isp-1(qm150) mutation caused considerably stronger hsp-60pr::gfp induction suggestive of a larger impact on mitochondrial function [29] (Figure 1B)." | Paper_evidence | WBPaper00041212 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| "Thus, it is plausible that there could be crosstalk between CLK-1 nuclear signalling and the UPRmt. Indeed, we found that the expression of an UPRmt-responsive fluorescent reporter, which is activated in clk-1 null worms, was significantly reduced in the presence of CLK-1-nuc(+) (Fig. 6a)." | Paper_evidence | WBPaper00046786 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Rescued_by_transgene | WBTransgene00020965 | ||||||||
| Phenotype_assay | Genotype | hsp-60p::gfp | Paper_evidence | WBPaper00041370 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| hsp-60pr::gfp | Paper_evidence | WBPaper00041212 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| zcIs13 [hsp-6::GFP] | Paper_evidence | WBPaper00046786 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001282 | Paper_evidence | WBPaper00039867 | |||||||
| Curator_confirmed | WBPerson431 | ||||||||
| Remark | Biochemical measurements. Not behavioral. | Paper_evidence | WBPaper00039867 | ||||||
| Curator_confirmed | WBPerson431 | ||||||||
| WBPhenotype:0001350 | Paper_evidence | WBPaper00041212 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "... phospho-eIF2a levels were increased relative to total eIF2a protein levels in the clk-1(qm30) mutant... (Figure 4A)." | Paper_evidence | WBPaper00041212 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001621 | Paper_evidence | WBPaper00036073 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Worms are more sensitive to oxidative stress than wild-type worms. | At 0.2 mM paraquat, worms showed early developmental arrest in response to oxidative stress. | Worms all showed developmental deficits compared to N2 worms. | Paper_evidence | WBPaper00036073 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Affected_by | Molecule | WBMol:00004938 | Paper_evidence | WBPaper00036073 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBMol:00002747 | Paper_evidence | WBPaper00036073 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001696 | Paper_evidence | WBPaper00046786 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | clk-1(qm30) worms exhibit reduced biosynthesis of ubiquinone (Figure 3c); "We next crossed transgenic worms expressing either full-length CLK-1 (clk-1-wt) or this truncated nuclear-only form of CLK-1 (clk-1-nuc(+)) with the clk-1 null worm qm30 (clk-1(-)). As expected, full-length CLK-1 was able to rescue ubiquinone biosynthesis in these worms; however, CLK-1-nuc(+) could not (Fig. 3c). This infers that, similar to nuclear COQ7 in human cells, nuclear CLK-1 does not contribute to the mitochondrial biosynthetic role of CLK-1 in worms." | Paper_evidence | WBPaper00046786 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Rescued_by_transgene | WBTransgene00020964 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00046786 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | GO_term | GO:0006744 | PATO:0000460 | Paper_evidence | WBPaper00046786 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Molecule_affected | WBMol:00001550 | PATO:0000460 | Paper_evidence | WBPaper00046786 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Treatment | Ubiquinone levels detected by reverse-phase HPLC chromatograms of quinones extracted from worm strains | Paper_evidence | WBPaper00046786 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002163 | Paper_evidence | WBPaper00036073 | |||||||
| WBPaper00041212 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPerson2987 | |||||||||
| Remark | Measurement of whole-worm oxygen consumption in day 1 adult worms revealed that Clk mutants showed decreased oxygen consumption compared to wild-type worms. | Unlike control animals, the Clk mutants do not show any decrease in oxygen consumption from day 1 to day 7. | Paper_evidence | WBPaper00036073 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| "clk-1(qm30) worms displayed a slight reduction in oxygen consumption when compared to wild-type worms consistent with mild mitochondrial dysfunction (Figure 5E) [40]." | Paper_evidence | WBPaper00041212 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0002238 | Paper_evidence | WBPaper00046786 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Expression of CLK-1-nuc(+) in clk-1 null worms partially rescued the increased ROS levels observed in these animals (Fig. 4a)." | Paper_evidence | WBPaper00046786 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Rescued_by_transgene | WBTransgene00020965 | ||||||||
| EQ_annotations | GO_term | GO:1903409 | PATO:0000460 | Paper_evidence | WBPaper00046786 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Molecule_affected | WBMol:00001911 | PATO:0000460 | Paper_evidence | WBPaper00046786 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Treatment | Animals were stained with the reactive oxygen species (ROS)-sensitive dye DHE | Paper_evidence | WBPaper00046786 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002359 | Paper_evidence | WBPaper00041212 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "In order to examine levels of oxidative damage in mitochondrial stressed worms, we visualized the accumulation of carbonylated proteins using the Oxyblot system [44]. Consistent with the clk-1(qm30) mutation causing mitochondrial dysfunction, significantly more carbonylated material was detected in lysates from clk-1(qm30) worms than lysates from wild-type worms (Figure 5F)." | Paper_evidence | WBPaper00041212 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002468 | Paper_evidence | WBPaper00055188 | |||||||
| Curator_confirmed | WBPerson21876 | ||||||||
| Remark | Reduced polysome number | Paper_evidence | WBPaper00055188 | ||||||
| Curator_confirmed | WBPerson21876 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000114 | Paper_evidence | WBPaper00046786 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | clk-1(qm30) does not affect mRNA levels of the gene hsp-4 | Paper_evidence | WBPaper00046786 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000246 | Paper_evidence | WBPaper00031896 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Although animals exhibited an extended mean time between execution of the defecation motor program, the variance between DMP activation was not significantly different from wild-type. | Paper_evidence | WBPaper00031896 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001574 | Paper_evidence | WBPaper00036073 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | ATP levels are normal, with a trend towards and increase, despite decreased mitochondrial function. | Paper_evidence | WBPaper00036073 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0002087 | Paper_evidence | WBPaper00031326 | |||||||
| Curator_confirmed | WBPerson2857 | ||||||||
| Remark | growth in hydrogen sulfide enhances thermotolerance relative to untreated animals | Paper_evidence | WBPaper00031326 | ||||||
| Curator_confirmed | WBPerson2857 | ||||||||
| Reference | WBPaper00038379 | ||||||||
| WBPaper00039867 | |||||||||
| WBPaper00041212 | |||||||||
| WBPaper00041370 | |||||||||
| WBPaper00041750 | |||||||||
| WBPaper00017902 | |||||||||
| WBPaper00015392 | |||||||||
| WBPaper00011038 | |||||||||
| WBPaper00021890 | |||||||||
| WBPaper00017025 | |||||||||
| WBPaper00036073 | |||||||||
| WBPaper00031896 | |||||||||
| WBPaper00027157 | |||||||||
| WBPaper00006515 | |||||||||
| WBPaper00031326 | |||||||||
| WBPaper00006155 | |||||||||
| WBPaper00027130 | |||||||||
| WBPaper00010277 | |||||||||
| WBPaper00025727 | |||||||||
| WBPaper00016841 | |||||||||
| WBPaper00018757 | |||||||||
| WBPaper00005534 | |||||||||
| WBPaper00006261 | |||||||||
| WBPaper00015771 | |||||||||
| WBPaper00006240 | |||||||||
| WBPaper00045829 | |||||||||
| WBPaper00046786 | |||||||||
| WBPaper00051094 | |||||||||
| WBPaper00055188 | |||||||||
| WBPaper00065803 | |||||||||
| Method | Deletion_allele |
