WormBase Tree Display for Variation: WBVar00241238
expand all nodes | collapse all nodes | view schema
WBVar00241238 | Evidence | Paper_evidence | WBPaper00006240 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | ZC395 | |||
Flanking_sequences | acaagattacgtgatgaggagcttcatcat | aacttctgatgatgaccagaactttttttc | |||||
Mapping_target | ZC395 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00026639 | ||||||
WBStrain00026647 | |||||||
Laboratory | MQ | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00000536 | |||||
Transcript | ZC395.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
cDNA_position | 454-? | ||||||
CDS_position | 454-? | ||||||
Protein_position | 152-? | ||||||
Intron_number | 4/5 | ||||||
Exon_number | 4-6/6 | ||||||
Interactor (69) | |||||||
Genetics | Interpolated_map_position | III | -1.84661 | ||||
Description | Phenotype (25) | ||||||
Phenotype_not_observed | WBPhenotype:0000114 | Paper_evidence | WBPaper00046786 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | clk-1(qm30) does not affect mRNA levels of the gene hsp-4 | Paper_evidence | WBPaper00046786 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000246 | Paper_evidence | WBPaper00031896 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Although animals exhibited an extended mean time between execution of the defecation motor program, the variance between DMP activation was not significantly different from wild-type. | Paper_evidence | WBPaper00031896 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001574 | Paper_evidence | WBPaper00036073 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | ATP levels are normal, with a trend towards and increase, despite decreased mitochondrial function. | Paper_evidence | WBPaper00036073 | ||||
Curator_confirmed | WBPerson712 | ||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002087 | Paper_evidence | WBPaper00031326 | |||||
Curator_confirmed | WBPerson2857 | ||||||
Remark | growth in hydrogen sulfide enhances thermotolerance relative to untreated animals | Paper_evidence | WBPaper00031326 | ||||
Curator_confirmed | WBPerson2857 | ||||||
Reference (30) | |||||||
Method | Deletion_allele |