WormBase Tree Display for Variation: WBVar00249300
expand all nodes | collapse all nodes | view schema
WBVar00249300 | Name | Public_name | tm246 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C44C1.4.1:c.-84_482del | ||||||||
HGVSg | CHROMOSOME_X:g.973659_974836del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C44C1 | |||||
Flanking_sequences | aactgcaacaatagcgcaataattccgcac | cgtctctgtcaccgcgtcgggtgagtgtcc | |||||||
Mapping_target | C44C1 | ||||||||
Source_location | 7 | CHROMOSOME_X | 973658 | 974837 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm246_external | ||||||||
tm246_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 246 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00171379 | |||||||
WBGene00016643 | |||||||||
Transcript | C44C1.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,start_lost,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C44C1.4.1:c.-84_482del | ||||||||
cDNA_position | 13-578 | ||||||||
CDS_position | ?-482 | ||||||||
Protein_position | ?-161 | ||||||||
Intron_number | 2-4/12 | ||||||||
Exon_number | 1-5/13 | ||||||||
C44C1.13 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | X | |||||||
Description | Phenotype | WBPhenotype:0000054 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as maternal effect larval lethal by the National Bioresource Project of Japan. Comment to NBP from Dr. S. Mitani: EMBOR 8, 152 (2007). Comment to NBP from Dr. S. L'Hernault: could not recover. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
SL | |||||||||
Maternal | With_maternal_effect | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000638 | Paper_evidence | WBPaper00029049 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Arrested larvae were often encased in the old cuticle. | Paper_evidence | WBPaper00029049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15, 25 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000710 | Paper_evidence | WBPaper00029049 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Intestines of arrested larva showed enlarged lumens and accumulation of large refractile granules, thought to be lysosome-related organelles. In addition, multilamellar bodies (MBLs) were observed in the intestines by electron microscopy. | Paper_evidence | WBPaper00029049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005772 | PATO:0000460 | Paper_evidence | WBPaper00029049 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005791 | PATO:0000460 | Paper_evidence | WBPaper00029049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15, 25 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000911 | Paper_evidence | WBPaper00029049 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Coelomocytes contained aberrantly small RME-8/GFP vesicles, which accumulated in the peripheral regions. Results were repeated with another endosomal marker containing 2 x FYVE domain. | Paper_evidence | WBPaper00029049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | RME-8/GFP | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001015 | Paper_evidence | WBPaper00029049 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | A shift to a higher temperature at any stage resulted in developmental arrest. | Paper_evidence | WBPaper00029049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001425 | Paper_evidence | WBPaper00029049 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The vitellogenin::EGFP reporter (YP170/EGFP) was not endocytosed by oocytes at 25C. | Paper_evidence | WBPaper00029049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15, 25 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | vitellogenin::EGFP (YP170/EGFP) | Paper_evidence | WBPaper00029049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00029049 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Pmyo-3::ssGFP, secreted by muscle cells, was not taken up by coelomocytes and instead accumulated in the pseudocoelom. | Paper_evidence | WBPaper00029049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005751 | PATO:0000460 | Paper_evidence | WBPaper00029049 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15, 25 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | Pmyo-3::ssGFP | Paper_evidence | WBPaper00029049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001754 | Paper_evidence | WBPaper00029049 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Texas Red-BSA remained in RME-8-positive endosomes in vps-45 mutant coelomocytes at 30 min after TR-BSA injection, in contrast to TR-BSA reaching lysosomal-associated membrane protein ortholog (LMP-1)/GFP-labeled compartments at 45 min in control animals. | Paper_evidence | WBPaper00029049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005751 | PATO:0000460 | Paper_evidence | WBPaper00029049 | ||||
Curator_confirmed | WBPerson712 | ||||||||
GO_term | GO:0008333 | PATO:0000460 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were injected with Texas-Red-conjugated BSA. | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 15, 25 | Paper_evidence | WBPaper00029049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | RME-8/GFP, LMP-1/GFP | Paper_evidence | WBPaper00029049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000103 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. G. Hermann to the National Bioresource Project of Japan: WT gut granules. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | GH | ||||||||
WBPhenotype:0000706 | Paper_evidence | WBPaper00025094 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutations did not result in Glo phenotypes | Paper_evidence | WBPaper00025094 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00025094 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00025094 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Staining with LysoTracker Red and acridine orange | Paper_evidence | WBPaper00025094 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002562 | Paper_evidence | WBPaper00029049 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | There was no obvious reduction in the size of the LMP-1/GFP-labelled lysosomes. | Paper_evidence | WBPaper00029049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | GO_term | GO:0007040 | PATO:0000460 | Paper_evidence | WBPaper00029049 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | LMP-1/GFP | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:0112132 | |||||||
Models_disease_in_annotation | WBDOannot00001370 | ||||||||
Reference | WBPaper00025094 | ||||||||
WBPaper00029049 | |||||||||
Remark | 15824/15825-17002/17003 (1178 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |