WormBase Tree Display for Variation: WBVar00249428
expand all nodes | collapse all nodes | view schema
WBVar00249428 | Name | Public_name | tm380 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C40C9.2.1:c.363-29_797delinsAATGGGGAAGCCATAAG | |||||||
HGVSg | CHROMOSOME_X:g.13644026_13645475delinsCTTATGGCTTCCCCATT | |||||||
Sequence_details | SMap | S_parent | Sequence | C40C9 | ||||
Flanking_sequences | aacgtaattttttcaccagcatccggaggt | gcgctgaagtttgtattgtctagaaaataa | ||||||
Mapping_target | C40C9 | |||||||
Source_location | 7 | CHROMOSOME_X | 13644025 | 13645476 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | CTTATGGCTTCCCCATT | ||||||
Deletion | ||||||||
PCR_product | tm380_external | |||||||
tm380_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 380 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00200949 | ||||||
WBGene00000048 | ||||||||
WBGene00202225 | ||||||||
Transcript | C40C9.15 | VEP_consequence | transcript_ablation | |||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
C40C9.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C40C9.2.1:c.363-29_797delinsAATGGGGAAGCCATAAG | |||||||
cDNA_position | ?-927 | |||||||
CDS_position | ?-797 | |||||||
Protein_position | ?-266 | |||||||
Intron_number | 4-7/14 | |||||||
Exon_number | 5-8/15 | |||||||
C40C9.16 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000681 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. J-L. Besereau to the National Bioresource Project of Japan: sensitive to nicotinic agonist DMPP. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 13076/13077-CTTATGGCTTCCCCATT-14526/14527 (1450 deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |