WormBase Tree Display for Variation: WBVar00249430

WBVar00249430 Name: Public_name: tm382
    Other_name: C25F6.4.1:c.214_402+121del
    HGVSg: CHROMOSOME_X:g.5461533_5461889del
  Sequence_details: SMap: S_parent: Sequence: C25F6
    Flanking_sequences: gagctggcatcgggagcctggtgtccgaag aagataaatacgcaacctgaggttgtaact
    Mapping_target: C25F6
    Source_location: 7 CHROMOSOME_X 5461532 5461890 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm382_external
      tm382_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 382
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00016104
    Transcript: C25F6.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C25F6.4.1:c.214_402+121del
        cDNA_position: 240-?
        CDS_position: 214-?
        Protein_position: 72-?
        Intron_number: 3-4/16
        Exon_number: 3-4/17
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000195 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Hengartner to the National Bioresource Project of Japan: no defects in DTC migration. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000885 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Hengartner to the National Bioresource Project of Japan: no defects in phagocytosis. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 16865/16866-17222/17223 (357 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele