WormBase Tree Display for Variation: WBVar00249886

WBVar00249886 Name: Public_name: tm861
    Other_name: C27B7.8.1:c.126+79_253del
    HGVSg: CHROMOSOME_IV:g.8918022_8918521del
  Sequence_details: SMap: S_parent: Sequence: C27B7
    Flanking_sequences: ccataagatcattgaatgtcgattgagcag tcgagactaggtgccgtattttttgccgta
    Mapping_target: C27B7
    Source_location: 7 CHROMOSOME_IV 8918021 8918522 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm861_external
      tm861_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 861
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004307
    Transcript: C27B7.8.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C27B7.8.1:c.126+79_253del
        cDNA_position: ?-369
        CDS_position: ?-253
        Protein_position: ?-85
        Intron_number: 3-4/7
        Exon_number: 4-5/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. O. Blacque: could not examine Dyf phenotype. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 28495/28496-28995/28996 (500 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele