WormBase Tree Display for Variation: WBVar00249888
expand all nodes | collapse all nodes | view schema
WBVar00249888 | Name | Public_name | tm863 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE28078:p.Leu158_Pro302delinsPheTer | |||||||
T09A5.3.1:c.474_906delinsCTGAAGC | ||||||||
HGVSg | CHROMOSOME_II:g.7848445_7849069delinsGCTTCAG | |||||||
Sequence_details | SMap | S_parent | Sequence | T09A5 | ||||
Flanking_sequences | tccaagtagaggtacagcttcagatgttgt | aactgcaatatttcctgtatacttacagta | ||||||
Mapping_target | T09A5 | |||||||
Source_location | 7 | CHROMOSOME_II | 7848444 | 7849070 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | GCTTCAG | ||||||
Deletion | ||||||||
PCR_product | tm863_external | |||||||
tm863_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00007571 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 863 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000046 | ||||||
Transcript | T09A5.3.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype (12) | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00041959 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Authors refer to this as tn863, not tm863 in the paper. | Paper_evidence | WBPaper00041959 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000681 | Paper_evidence | WBPaper00027611 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Scored as DMPP sensitive. | Paper_evidence | WBPaper00027611 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00000896 | Paper_evidence | WBPaper00027611 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000964 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Comment from Dr. J-L. Bessereau to the National Bioresource Project of Japan: sensitive to nicotinic agonist DMPP after backcross. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001468 | Paper_evidence | WBPaper00041959 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Mutant worms exhibited a normal approach to a benzaldehyde stimulus. Authors refer to this as tn863, not tm863 in the paper. | Paper_evidence | WBPaper00041959 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Worms placed on chemotaxis plates spotted with 0.01% benzaldehyde. | Paper_evidence | WBPaper00041959 | ||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00041959 | |||||||
WBPaper00043908 | ||||||||
WBPaper00027611 | ||||||||
Remark | 16544/16545-GCTTCAG-17169/17170 (625 bp deletion + 7 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |