WormBase Tree Display for Variation: WBVar00249946
expand all nodes | collapse all nodes | view schema
WBVar00249946 | Name | Public_name | tm924 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE01781:p.Lys79_Ter201delinsThrAlaAspMetAsnTyrPheHis | ||||||||
C14F5.2.1:c.236_601delinsCGGCCGATATGAACTACTTCC | |||||||||
HGVSg | CHROMOSOME_X:g.7931078_7931498delinsCGGCCGATATGAACTACTTCC | ||||||||
Sequence_details | SMap | S_parent | Sequence | C14F5 | |||||
Flanking_sequences | ccacaccgactggagtcatttactgggaaa | acagcggccgatatgaactacttccatccg | |||||||
Mapping_target | C14F5 | ||||||||
Source_location | 7 | CHROMOSOME_X | 7931077 | 7931499 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Insertion | CGGCCGATATGAACTACTTCC | |||||||
Deletion | |||||||||
PCR_product | tm924_external | ||||||||
tm924_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 924 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006980 | |||||||
Transcript | C14F5.2.1 (11) | ||||||||
Interactor | WBInteraction000009148 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | X | |||||||
Description | Phenotype | WBPhenotype:0001503 | Paper_evidence | WBPaper00035166 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Neuroanatomical analysis of ventral nerve cord architecture in these mutants demonstrate a post-developemental axon flip-over phenotype involving PVQ and PVP axons. No defects were seen in the maintenance of other neuron axons or soma. | Paper_evidence | WBPaper00035166 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006976 | PATO:0000460 | Paper_evidence | WBPaper00035166 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006832 | PATO:0000460 | Paper_evidence | WBPaper00035166 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00035166 | ||||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. M. Peter: does not suppress par-2 (RNAi). | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence (2) | |||||||||
WBPhenotype:0000072 | Paper_evidence | WBPaper00035166 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit any gross morphological defects compared to control animals. | Paper_evidence | WBPaper00035166 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000180 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. O. Hobert to the National Bioresource Project of Japan: no axonal defects in PVQ neurons. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | OH | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006976 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000517 | Paper_evidence | WBPaper00035166 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000672 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. K. Shen to the National Bioresource Project of Japan: HSN presynaptic vesicle localization normal. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | TV | ||||||||
WBPhenotype:0000880 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. O. Hobert to the National Bioresource Project of Japan: no axonal defects in PVQ neurons. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | OH | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006976 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000905 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. Dr. T. Kubo to the National Bioresource Project of Japan: normal AIM morphology. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | UTK | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006814 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00035166 | ||||||||
Remark | 1484/1485-CGGCCGATATGAACTACTTCC-1905/1906 (421 bp deletion +21 bp insertion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |