WormBase Tree Display for Variation: WBVar00250121
expand all nodes | collapse all nodes | view schema
WBVar00250121 | Name | Public_name | tm1104 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F11A6.1a.1:c.487_956+17del | |||||||
F11A6.1a.2:c.487_956+17del | ||||||||
HGVSg | CHROMOSOME_I:g.11677017_11678257del | |||||||
Sequence_details | SMap | S_parent | Sequence | F11A6 | ||||
Flanking_sequences | atttttgaagaggatgatgatggtactcaa | gaattgagccaaaatttacaatttcatcag | ||||||
Mapping_target | F11A6 | |||||||
Source_location | 7 | CHROMOSOME_I | 11677016 | 11678258 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1104_external | |||||||
tm1104_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1104 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002232 | ||||||
Transcript | F11A6.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F11A6.1a.1:c.487_956+17del | |||||||
cDNA_position | 587-? | |||||||
CDS_position | 487-? | |||||||
Protein_position | 163-? | |||||||
Intron_number | 3-4/8 | |||||||
Exon_number | 3-4/9 | |||||||
F11A6.1a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F11A6.1a.2:c.487_956+17del | |||||||
cDNA_position | 591-? | |||||||
CDS_position | 487-? | |||||||
Protein_position | 163-? | |||||||
Intron_number | 3-4/8 | |||||||
Exon_number | 3-4/9 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Phenotype_not_observed | WBPhenotype:0002535 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. S. Shaham to the National Bioresource Project of Japan: no apparent defects in amphid dendrite structure. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark (2) | ||||||||
Method | NBP_knockout_allele |