WormBase Tree Display for Variation: WBVar00250146

WBVar00250146 Name: Public_name: tm1129
    HGVSg
  Sequence_details: SMap: S_parent: Sequence: F29C4
    Flanking_sequences: ggcttcgcagtggggtgtggcgtagattgtaaaagtgcaaaatttctag gcaagaatggacaaaatcctgtctctggtg
    Mapping_target: F29C4
    Source_location: 7 CHROMOSOME_IV 114569 114901 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GGGGATGNGG
      Deletion
    PCR_product: tm1129_external
      tm1129_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1129
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001111
    Pseudogene: F29C4.5 VEP_consequence: intron_variant,non_coding_transcript_variant
        VEP_impact: MODIFIER
        Intron_number: 1/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype_not_observed: WBPhenotype:0000032 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Inoue to the National Bioresource Project of Japan: healthy. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000315 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Inoue to the National Bioresource Project of Japan: normal response to touch and tap stimuli. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Inoue to the National Bioresource Project of Japan: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000680 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. J. Kaplan to the National Bioresource Project of Japan: WT aldicarb response. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: KP
        Affected_by: Molecule: WBMol:00003650 Person_evidence: WBPerson7743
              Curator_confirmed: WBPerson712
  Remark: 4817/4818-GGGGATGNGG-5148/5149 (331 bp deletion + 10 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele