WormBase Tree Display for Variation: WBVar00250253
expand all nodes | collapse all nodes | view schema
WBVar00250253 | Name | Public_name | tm1245 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T24B8.7a.1:c.319-101_1086-21del | |||||||
T24B8.7d.1:c.154-101_921-21del | ||||||||
T24B8.7h.1:c.319-101_1086-21del | ||||||||
T24B8.7e.1:c.154-101_921-21del | ||||||||
T24B8.7f.1:c.154-101_921-21del | ||||||||
T24B8.7c.1:c.154-101_921-21del | ||||||||
T24B8.7g.1:c.319-101_1086-21del | ||||||||
T24B8.7b.1:c.319-101_1086-21del | ||||||||
HGVSg | CHROMOSOME_II:g.9051740_9052773del | |||||||
Sequence_details | SMap | S_parent | Sequence | T24B8 | ||||
Flanking_sequences | ttcgcgttctctataaaaaaaaattaattt | cgtttgcctctactatttcaatttgctttg | ||||||
Mapping_target | T24B8 | |||||||
Source_location | 7 | CHROMOSOME_II | 9051739 | 9052774 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1245_external | |||||||
tm1245_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1245 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00011980 | ||||||
Transcript | T24B8.7c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T24B8.7c.1:c.154-101_921-21del | |||||||
Intron_number | 1-4/26 | |||||||
Exon_number | 2-4/27 | |||||||
T24B8.7b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T24B8.7b.1:c.319-101_1086-21del | |||||||
Intron_number | 3-6/28 | |||||||
Exon_number | 4-6/29 | |||||||
T24B8.7a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T24B8.7a.1:c.319-101_1086-21del | |||||||
Intron_number | 3-6/29 | |||||||
Exon_number | 4-6/30 | |||||||
T24B8.7d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T24B8.7d.1:c.154-101_921-21del | |||||||
Intron_number | 1-4/26 | |||||||
Exon_number | 2-4/27 | |||||||
T24B8.7f.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T24B8.7f.1:c.154-101_921-21del | |||||||
Intron_number | 1-4/13 | |||||||
Exon_number | 2-4/14 | |||||||
T24B8.7e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T24B8.7e.1:c.154-101_921-21del | |||||||
Intron_number | 1-4/14 | |||||||
Exon_number | 2-4/15 | |||||||
T24B8.7g.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T24B8.7g.1:c.319-101_1086-21del | |||||||
Intron_number | 3-6/15 | |||||||
Exon_number | 4-6/16 | |||||||
T24B8.7h.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T24B8.7h.1:c.319-101_1086-21del | |||||||
Intron_number | 3-6/15 | |||||||
Exon_number | 4-6/16 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype | WBPhenotype:0000017 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. L. Dreier to the National Bioresource Project of Japan: Ric | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | IY | |||||||
Affected_by | Molecule | WBMol:00003650 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000436 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. L. Dreier to the National Bioresource Project of Japan: normal GLR-1::GFP localization | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | IY | |||||||
Remark | 1330/1331-2364/2365 (1034 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |