WormBase Tree Display for Variation: WBVar00250388

WBVar00250388 Name: Public_name: tm1395
    Other_name: Y71F9B.7.1:c.718-37_1040del
    HGVSg: CHROMOSOME_I:g.2756771_2757130del
  Sequence_details: SMap: S_parent: Sequence: Y71F9B
    Flanking_sequences: tccattcggtgagtttgctgccgttcagaa atataggcgtggcgtaatttcgcaactctg
    Mapping_target: Y71F9B
    Source_location: 7 CHROMOSOME_I 2756770 2757131 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1395_external
      tm1395_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1395
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004043
    Transcript: Y71F9B.7.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y71F9B.7.1:c.718-37_1040del
        cDNA_position: ?-1040
        CDS_position: ?-1040
        Protein_position: ?-347
        Intron_number: 3/6
        Exon_number: 4/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
    Mapping_data: In_multi_point: 4835
        4867
  Description: Phenotype: WBPhenotype:0000016 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan: Dr. J. Kaplan: weak hypersensitivity to aldicarb Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
        Affected_by: Molecule: WBMol:00003650 Person_evidence: WBPerson7743
              Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0007833 PATO:0001549 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
      WBPhenotype:0000050 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan: Dr. A. Dernburg: ~65% embryonic inviability. Dr. M. Zetka: high incidence of embryonic lethality. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0001175 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan: Dr. A. Dernburg: Him. Dr. M. Zetka: mild Him. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the National Bioresource Project of Japan: Dr. A. Dernburg: ~65% embryonic inviability. Dr. M. Zetka: high incidence of embryonic lethality Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000112 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan: Dr. J. Kaplan: not GLR::GFP phenotype Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 55179/55180-55539/55540 (360 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele