WormBase Tree Display for Variation: WBVar00250404
expand all nodes | collapse all nodes | view schema
WBVar00250404 | Name | Public_name | tm1411 | ||||||
---|---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_I:g.5869387_5870043delinsATATGTATATA | ||||||||
Sequence_details | SMap | S_parent | Sequence | F33D11 | |||||
Flanking_sequences | cctcgttcctaaccgcaaaggtttttgtat | tgttttttttctattggtatttacgtacat | |||||||
Mapping_target | F33D11 | ||||||||
Source_location | 7 | CHROMOSOME_I | 5869386 | 5870044 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Insertion | ATATGTATATA | |||||||
Deletion | |||||||||
PCR_product | tm1411_external | ||||||||
tm1411_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00036627 | ||||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 1411 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00018008 | |||||||
Transcript | F33D11.11.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
cDNA_position | ?-410 | ||||||||
CDS_position | ?-403 | ||||||||
Protein_position | ?-135 | ||||||||
Intron_number | 2/5 | ||||||||
Exon_number | 1-3/6 | ||||||||
Interactor | WBInteraction000520676 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | I | |||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | N=1045 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000013 | PATO:0000460 | Paper_evidence | WBPaper00031951 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were reared on NA22 bacteria instead of OP50. | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000054 | Paper_evidence | WBPaper00031951 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | N=1045 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00031951 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were reared on NA22 bacteria instead of OP50. | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. A. Chisholm: maternal effect Let. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
CZ | |||||||||
Maternal | With_maternal_effect | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000195 | Paper_evidence | WBPaper00031951 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed defects in DTC migration along the ventral body wall muscle between the hyp7 hypodermal syncytium (phase 1) and during the migration along the dorsal body wall muscle (phase 3), and, to a low extent, while crossing hyp7 (phase 2), as visualized by lag-2::GFP expression. | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00031951 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were reared on NA22 bacteria instead of OP50. | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000520 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. A. Chisholm: morphogenesis defects. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | CZ | ||||||||
Maternal | With_maternal_effect | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00031951 | |||||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | FX | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031951 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were reared on NA22 bacteria instead of OP50. | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001140 | Paper_evidence | WBPaper00031951 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Many head neurons were positioned posteriorly in mutants, as visualized by a pan-neuronal transgenic reporter and DiI uptake. | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006751 | PATO:0001922 | Paper_evidence | WBPaper00031951 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005394 | PATO:0001922 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
GO_term | GO:0051674 | PATO:0000460 | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were reared on NA22 bacteria instead of OP50. Amphid sensory neurons were labeled with DiI. | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001504 | Paper_evidence | WBPaper00051395 | |||||||
Curator_confirmed | WBPerson425 | ||||||||
WBPhenotype:0001566 | Paper_evidence | WBPaper00031951 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals had variable expressed enclosure defects, as assayed by 4D time-lapse DIC micrographs. | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000013 | PATO:0000460 | Paper_evidence | WBPaper00031951 | ||||
Curator_confirmed | WBPerson712 | ||||||||
GO_term | GO:0009790 | PATO:0000460 | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were reared on NA22 bacteria instead of OP50. | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001570 | Paper_evidence | WBPaper00040690 | |||||||
Curator_confirmed | WBPerson425 | ||||||||
Remark | abnormal mitochondrial localization | Paper_evidence | WBPaper00040690 | ||||||
Curator_confirmed | WBPerson425 | ||||||||
EQ_annotations | GO_term | GO:0005739 | PATO:0000460 | Paper_evidence | WBPaper00040690 | ||||
Curator_confirmed | WBPerson425 | ||||||||
Disease_info | Models_disease | DOID:332 | |||||||
Models_disease_in_annotation | WBDOannot00000522 | ||||||||
Reference | WBPaper00040690 | ||||||||
WBPaper00031951 | |||||||||
WBPaper00051395 | |||||||||
Remark | 36170/36171-ATATGTATATA-36827/36828 (657 bp deletion + 11 bp insertion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |