WormBase Tree Display for Variation: WBVar00250482

WBVar00250482 Name: Public_name: tm1490
    Other_name: Y105E8A.19.1:c.583_682+215del
    HGVSg: CHROMOSOME_I:g.14484416_14484730del
  Sequence_details: SMap: S_parent: Sequence: Y105E8A
    Flanking_sequences: gaaaatttgacgcttttccaatttttcagc aaattgtccatcaaccttcaaatattgttc
    Mapping_target: Y105E8A
    Source_location: 7 CHROMOSOME_I 14484415 14484731 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1490_external
      tm1490_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1490
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00013677
    Transcript: Y105E8A.19.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y105E8A.19.1:c.583_682+215del
        cDNA_position: 600-?
        CDS_position: 583-?
        Protein_position: 195-?
        Intron_number: 3/7
        Exon_number: 3/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 151255/151256-151570/151571 (315 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele