WormBase Tree Display for Variation: WBVar00250501

WBVar00250501 Name: Public_name: tm1509
    HGVSg
  Sequence_details: SMap: S_parent: Sequence: F39H2
    Flanking_sequences: cccatttcacaacttcaagaagaccctcta ataatgcgaagagtgttgcgctctttgtag
    Mapping_target: F39H2
    Source_location: 7 CHROMOSOME_I 8662915 8663322 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TNATGAGAAGAGTG
      Deletion
    PCR_product: tm1509_external
      tm1509_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1509
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006377
      WBGene00045237
    Transcript: F39H2.4.2 VEP_consequence: coding_sequence_variant,3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 658-?
        CDS_position: 588-?
        Protein_position: 196-?
        Exon_number: 7-8/8
      F39H2.5.1 VEP_consequence: coding_sequence_variant,3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 1690-?
        CDS_position: 1684-?
        Protein_position: 562-?
        Exon_number: 9-10/10
      F39H2.4.1 VEP_consequence: coding_sequence_variant,3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 594-?
        CDS_position: 588-?
        Protein_position: 196-?
        Exon_number: 6-7/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment from the National Bioresource Project of Japan: Dr. A. Dernburg: Ste Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 14932/14933-TNATGAGAAGAGTG-15338/15339 (406 bp deletion + 14 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele