WormBase Tree Display for Variation: WBVar00250696

WBVar00250696 Name: Public_name: tm1729
    Other_name: F54A5.3b.1:c.-250_-111+268delinsAT
      F54A5.3a.1:c.138-67_210+268delinsAT
      F54A5.3b.2:c.-266-67_-194+268delinsAT
    HGVSg: CHROMOSOME_I:g.972380_972787delinsAT
  Sequence_details: SMap: S_parent: Sequence: F54A5
    Flanking_sequences: tgcaccatgtaacctttctctaataacctg cttcatgcctgcctaccgcctgatttctaa
    Mapping_target: F54A5
    Source_location: 7 CHROMOSOME_I 972379 972788 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AT
      Deletion
    PCR_product: tm1729_external
      tm1729_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1729
    NBP_allele
    Status: Live
  Affects (3)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description (2)
  Reference: WBPaper00032209
  Remark: 20469/20470-AT-20877/20878 (408 bp deletion + 2 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele