WormBase Tree Display for Variation: WBVar00250696
expand all nodes | collapse all nodes | view schema
WBVar00250696 | Name | Public_name | tm1729 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F54A5.3b.1:c.-250_-111+268delinsAT | |||||||
F54A5.3a.1:c.138-67_210+268delinsAT | ||||||||
F54A5.3b.2:c.-266-67_-194+268delinsAT | ||||||||
HGVSg | CHROMOSOME_I:g.972380_972787delinsAT | |||||||
Sequence_details | SMap | S_parent | Sequence | F54A5 | ||||
Flanking_sequences | tgcaccatgtaacctttctctaataacctg | cttcatgcctgcctaccgcctgatttctaa | ||||||
Mapping_target | F54A5 | |||||||
Source_location | 7 | CHROMOSOME_I | 972379 | 972788 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | AT | ||||||
Deletion | ||||||||
PCR_product | tm1729_external | |||||||
tm1729_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1729 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00018788 | ||||||
Transcript | F54A5.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F54A5.3a.1:c.138-67_210+268delinsAT | |||||||
Intron_number | 3-4/7 | |||||||
Exon_number | 4/8 | |||||||
F54A5.3b.3 | VEP_consequence | splice_donor_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 1/5 | |||||||
Exon_number | 1/6 | |||||||
F54A5.3b.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F54A5.3b.2:c.-266-67_-194+268delinsAT | |||||||
Intron_number | 2-3/7 | |||||||
Exon_number | 3/8 | |||||||
F54A5.3b.1 | VEP_consequence | splice_donor_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F54A5.3b.1:c.-250_-111+268delinsAT | |||||||
cDNA_position | 3725-? | |||||||
Intron_number | 2/6 | |||||||
Exon_number | 2/7 | |||||||
Interactor | WBInteraction000503796 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000591 | Paper_evidence | WBPaper00032209 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were hypersensitive to copper, and cadmium. Animals grew poorly on plates containing these metal ions and failed to reach the adult stage within 4 days. | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000593 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. K. Matsumoto: sensitive to copper. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0001349 | Paper_evidence | WBPaper00032209 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Phosphorylated PMK-1 levels were normal. | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001351 | Paper_evidence | WBPaper00032209 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Phosphorylated KGB-1 levels were significantly decreased, whether treated with Cu2+ or not. | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001724 | Paper_evidence | WBPaper00032209 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were cultured from embryogenesis on normal plates containing 1 ug/ml tunicamycin. The percentage of worms reaching adulthood 4 days after egg laying was scored. | Paper_evidence | WBPaper00032209 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed (5) | ||||||||
Reference | WBPaper00032209 | |||||||
Remark (2) | ||||||||
Method | NBP_knockout_allele |