WormBase Tree Display for Variation: WBVar00251160

WBVar00251160 Name: Public_name: tm2243
    Other_name: F14F4.1.1:c.376-314_927delinsTAC
    HGVSg: CHROMOSOME_X:g.14925355_14926494delinsGTA
  Sequence_details: SMap: S_parent: Sequence: F14F4
    Flanking_sequences: gttaaggcaagaatttagatttccaagtat taaattagacataccaactcagaatgaatg
    Mapping_target: F14F4
    Source_location: 7 CHROMOSOME_X 14925354 14926495 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GTA
      Deletion
    PCR_product: tm2243_external
      tm2243_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2243
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00008808
    Transcript: F14F4.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F14F4.1.1:c.376-314_927delinsTAC
        cDNA_position: ?-947
        CDS_position: ?-927
        Protein_position: ?-309
        Intron_number: 4-9/11
        Exon_number: 5-10/12
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000154 Paper_evidence: WBPaper00053007
        Curator_confirmed: WBPerson39110
        Remark: reduction in reproductive capacity Paper_evidence: WBPaper00053007
            Curator_confirmed: WBPerson39110
      WBPhenotype:0001983 Paper_evidence: WBPaper00053007
        Curator_confirmed: WBPerson39110
        Remark: Progeny enhanced food leaving is observed in N2 wild type. ntr-2(tm2243) mutant is deficient in this enhanced food leaving Paper_evidence: WBPaper00053007
            Curator_confirmed: WBPerson39110
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment from Dr. C. Bargmann to the NBP: viable. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000478 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C. Bargmann to the National Bioresource Project of Japan: normal thermotaxis. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C. Bargmann to the National Bioresource Project of Japan: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0002535 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. P. Senguputa to the National Bioresource Project of Japan: normal dye filling. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Reference: WBPaper00053007
  Remark: 2875/2876-GTA-4015/4016 (1140 bp deletion + 3 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele