WormBase Tree Display for Variation: WBVar00251374

WBVar00251374 Name: Public_name: tm2497
    Other_name: R166.1a.1:c.730+25_818del
      R166.1a.2:c.730+25_818del
    HGVSg: CHROMOSOME_II:g.10531333_10531757del
  Sequence_details: SMap: S_parent: Sequence: R166
    Flanking_sequences: cgttgggttagtctttgtcgctgggcgttt aaccagctcaaacacatcccaccctgagct
    Mapping_target: R166
    Source_location: 7 CHROMOSOME_II 10531332 10531758 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2497_external
      tm2497_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2497
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003107
    Transcript: R166.1a.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: R166.1a.1:c.730+25_818del
        cDNA_position: ?-1067
        CDS_position: ?-818
        Protein_position: ?-273
        Intron_number: 6/10
        Exon_number: 7/11
      R166.1a.2 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: R166.1a.2:c.730+25_818del
        cDNA_position: ?-905
        CDS_position: ?-818
        Protein_position: ?-273
        Intron_number: 5/9
        Exon_number: 6/10
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000038 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Comment from Dr. R.H. Horvitz to the National Bioresource Project of Japan: often rupture from their vulva. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
      WBPhenotype:0000697 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Comment from Dr. R.H. Horvitz to the National Bioresource Project of Japan: Pvl. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 4036/4037-4461/4462 (425 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele