WormBase Tree Display for Variation: WBVar00251511

WBVar00251511 Name: Public_name: tm2664
    Other_name: CE41010:p.Ile671MetfsTer8
      T04H1.4a.1:c.1971_2329del
      CE21149:p.Ile657MetfsTer8
      T04H1.4b.1:c.2013_2371del
    HGVSg: CHROMOSOME_V:g.12248927_12249342del
  Sequence_details: SMap: S_parent: Sequence: T04H1
    Flanking_sequences: tgcaaaatcaaatctctacgattcttatat gtgtaattcaacaactctatgaacaaacag
    Mapping_target: T04H1
    Source_location: 7 CHROMOSOME_V 12248926 12249343 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2664_external
      tm2664_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2664
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004296
    Transcript: T04H1.4b.1 (11)
      T04H1.4a.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 14617/14618-15033/15034 (416 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele