WormBase Tree Display for Variation: WBVar00251552

WBVar00251552 Name: Public_name: tm2707
    Other_name: R166.1a.1:c.-85-1038_-85-482delinsGGTGATATCCG
    HGVSg: CHROMOSOME_II:g.10529299_10529855delinsGGTGATATCCG
  Sequence_details: SMap: S_parent: Sequence: R166
    Flanking_sequences: attttgaactttcgtatccccagacatcca gcaaaccttttttatgacttcgatagggaa
    Mapping_target: R166
    Source_location: 7 CHROMOSOME_II 10529298 10529857 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GGTGATATCCGT
      Deletion
    PCR_product: tm2707_external
      tm2707_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2707
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00199114
      WBGene00003107
      WBGene00198906
    Transcript: R166.9 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
      R166.1a.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: R166.1a.1:c.-85-1038_-85-482delinsGGTGATATCCG
        Intron_number: 1/10
      R166.8 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 29324/29325-GGTGATATCCGT-29882/29883 (558 bp deletion + 12 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target F59B10 updated based on the VEP analysis pipeline to R166.
  Method: NBP_knockout_allele