WormBase Tree Display for Variation: WBVar00252138
expand all nodes | collapse all nodes | view schema
WBVar00252138 | Name | Public_name | tm3463 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE32634:p.Leu97GlyfsTer13 | ||||||||
F21H12.1.1:c.288_1240del | |||||||||
HGVSg | CHROMOSOME_II:g.6098306_6099310del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F21H12 | |||||
Flanking_sequences | tgctgacaactccattgcaatgtttgatgt | tggacatagaaaatgcagacaacgatcaaa | |||||||
Mapping_target | F21H12 | ||||||||
Source_location | 7 | CHROMOSOME_II | 6098305 | 6099311 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm3463_external | ||||||||
tm3463_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 3463 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00017683 | |||||||
Transcript | F21H12.1.1 (11) | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | II | |||||||
Description | Phenotype | WBPhenotype:0000032 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr.J.M. Schumacher: Sck | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | JS | ||||||||
WBPhenotype:0000050 | Paper_evidence | WBPaper00038409 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutant produce 16% embryonic lethality at 25 deg C. | Paper_evidence | WBPaper00038409 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00038409 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00038409 | |||||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr.J.M. Schumacher: reduced brood size. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | JS | ||||||||
Average brood size 111 at 20 deg C, 54 at 25 deg C. | Paper_evidence | WBPaper00038409 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00038409 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000275 | Paper_evidence | WBPaper00060474 | |||||||
Curator_confirmed | WBPerson8633 | ||||||||
Remark | Figure 1, larval arrest and lifespan shortening were observed upon UV treatment. | Paper_evidence | WBPaper00060474 | ||||||
Curator_confirmed | WBPerson8633 | ||||||||
WBPhenotype:0000696 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr.J.M. Schumacher: Evl | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | JS | ||||||||
WBPhenotype:0000816 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. O. Hobert: ASE development defective. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | OH | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005663 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002078 | Paper_evidence | WBPaper00038409 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | At the eight-cell stage as well as at post-gastrulation, the H3K4me3 mark is undetectable in mutants compared to N2. H3K4me3 is undetectable in Western blot analysis. | Paper_evidence | WBPaper00038409 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
Reference | WBPaper00038409 | ||||||||
WBPaper00060474 | |||||||||
Remark | 16052/16053-17057/17058 (1005 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |