WormBase Tree Display for Variation: WBVar00252542
expand all nodes | collapse all nodes | view schema
WBVar00252542 | Name | Public_name | tm3980 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F43G6.6.1:c.360-29_836del | |||||||
HGVSg | CHROMOSOME_II:g.11807250_11807803del | |||||||
Sequence_details | SMap | S_parent | Sequence | F43G6 | ||||
Flanking_sequences | cacctcttgcctcttgcctacttatgtgcc | tgactttcatgtagactttggtggcaccag | ||||||
Mapping_target | F43G6 | |||||||
Source_location | 7 | CHROMOSOME_II | 11807249 | 11807804 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm3980_external | |||||||
tm3980_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 3980 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00005013 | ||||||
Transcript | F43G6.6.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F43G6.6.1:c.360-29_836del | |||||||
cDNA_position | ?-849 | |||||||
CDS_position | ?-836 | |||||||
Protein_position | ?-279 | |||||||
Intron_number | 3-4/8 | |||||||
Exon_number | 4-5/9 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype | WBPhenotype:0002436 | Paper_evidence | WBPaper00046626 | ||||
Curator_confirmed | WBPerson338 | |||||||
Remark | hypersensitive to DNA damage | Paper_evidence | WBPaper00046626 | |||||
Curator_confirmed | WBPerson338 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. A. Salcini: non-Unc. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | ZR | |||||||
Reference | WBPaper00046626 | |||||||
Remark | 29933/29934-30487/30488 (554 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |