WormBase Tree Display for Variation: WBVar00275573
expand all nodes | collapse all nodes | view schema
| WBVar00275573 | Evidence | Paper_evidence | WBPaper00036056 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ju89 | |||||
| Other_name | CE46730:p.Gly419Arg | ||||||
| F26E4.8a.1:c.1240G>C | |||||||
| F26E4.8b.1:c.1255G>C | |||||||
| CE09692:p.Gly414Arg | |||||||
| HGVSg | CHROMOSOME_I:g.9786043C>G | ||||||
| Sequence_details | SMap | S_parent | Sequence | F26E4 | |||
| Flanking_sequences | ccaagtcttcacgagcctcggtgaactctc | ctcctccattccttctccgacgtaccagtg | |||||
| Mapping_target | F26E4 | ||||||
| Type_of_mutation | Substitution | c | g | Curator_confirmed | WBPerson4055 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00005447 | ||||||
| Laboratory | CZ | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006528 | |||||
| Transcript (2) | |||||||
| Interactor | WBInteraction000525371 | ||||||
| Genetics | Interpolated_map_position | I | 3.90462 | ||||
| Description | Phenotype (10) | ||||||
| Reference | WBPaper00036056 | ||||||
| WBPaper00051394 | |||||||
| Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
| [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
| Method | Substitution_allele |
