WormBase Tree Display for Variation: WBVar00276076

WBVar00276076 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5478
    Other_name: C46E1.3.1:c.906T>G
      CE34758:p.Tyr302Ter
    HGVSg: CHROMOSOME_X:g.15475975A>C
  Sequence_details: SMap: S_parent: Sequence: C46E1
    Flanking_sequences: AACAACACTTGACGAAGAGAACGTTCTGGG TATGGAATTTCCCAGAGAACAATTTGTTGA
    Mapping_target: C46E1
    Type_of_mutation: Substitution: A C
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033305
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00001362
    Transcript: C46E1.3.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C46E1.3.1:c.906T>G
        HGVSp: CE34758:p.Tyr302Ter
        cDNA_position: 913
        CDS_position: 906
        Protein_position: 302
        Exon_number: 5/14
        Codon_change: taT/taG
        Amino_acid_change: Y/*
  Isolation: Mutagen: ENU
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele