WormBase Tree Display for Variation: WBVar00276403
expand all nodes | collapse all nodes | view schema
| WBVar00276403 | Evidence | Paper_evidence | WBPaper00036200 | ||
|---|---|---|---|---|---|
| Name | Public_name | gk2359 | |||
| Other_name | CE42671:p.Ser504Pro | ||||
| F25B5.7a.1:c.1510T>C | |||||
| CE42614:p.Ser224Pro | |||||
| F25B5.7c.1:c.670T>C | |||||
| HGVSg | CHROMOSOME_III:g.5953952A>G | ||||
| Sequence_details | SMap | S_parent | Sequence | F25B5 | |
| Flanking_sequences | CTCCTTCGATCATGTTACTCCGTCCGTGAG | TTTTGGAAGCATTCCTCCAGGACCTCCAGG | |||
| Mapping_target | F25B5 | ||||
| Type_of_mutation | Substitution | A | G | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00037339 | ||||
| Laboratory | VC | ||||
| Person | WBPerson427 | ||||
| Analysis | Million_Mutation_Pilot_Project | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00017778 | |||
| Transcript | F25B5.7c.1 | VEP_consequence | missense_variant | ||
| VEP_impact | MODERATE | ||||
| HGVSc | F25B5.7c.1:c.670T>C | ||||
| HGVSp | CE42614:p.Ser224Pro | ||||
| cDNA_position | 670 | ||||
| CDS_position | 670 | ||||
| Protein_position | 224 | ||||
| Exon_number | 3/4 | ||||
| Codon_change | Tct/Cct | ||||
| Amino_acid_change | S/P | ||||
| F25B5.7a.1 | VEP_consequence | missense_variant | |||
| VEP_impact | MODERATE | ||||
| HGVSc | F25B5.7a.1:c.1510T>C | ||||
| HGVSp | CE42671:p.Ser504Pro | ||||
| cDNA_position | 1541 | ||||
| CDS_position | 1510 | ||||
| Protein_position | 504 | ||||
| Exon_number | 7/9 | ||||
| Codon_change | Tct/Cct | ||||
| Amino_acid_change | S/P | ||||
| Isolation | Mutagen | ENU | |||
| Reference | WBPaper00036200 | ||||
| Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
| Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
| Method | KO_consortium_allele |
