WormBase Tree Display for Variation: WBVar00276405
expand all nodes | collapse all nodes | view schema
WBVar00276405 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5633 | |||
Other_name | F25B5.7a.1:c.1505C>A | ||||
CE42614:p.Pro222Gln | |||||
CE42671:p.Pro502Gln | |||||
F25B5.7c.1:c.665C>A | |||||
HGVSg | CHROMOSOME_III:g.5953957G>T | ||||
Sequence_details | SMap | S_parent | Sequence | F25B5 | |
Flanking_sequences | TCGATCATGTTACTCCGTCCGTGAGATTTT | GAAGCATTCCTCCAGGACCTCCAGGTCCTC | |||
Mapping_target | F25B5 | ||||
Type_of_mutation | Substitution | G | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033306 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00017778 | |||
Transcript | F25B5.7c.1 (12) | ||||
F25B5.7a.1 (12) | |||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |