WormBase Tree Display for Variation: WBVar00276437
expand all nodes | collapse all nodes | view schema
WBVar00276437 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk1645 | |||
Other_name | F28B3.5b.1:c.351C>T | ||||
F28B3.5a.1:c.351C>T | |||||
CE33383:p.Phe117= | |||||
CE28826:p.Phe117= | |||||
HGVSg | CHROMOSOME_I:g.4927179C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F28B3 | |
Flanking_sequences | TGTTCTCTCATTATTCCTTTACGATGCATT | TTCAGTGCAATCAGTGTTGCATGGGGAGCT | |||
Mapping_target | F28B3 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00036970 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00017886 | |||
Transcript | F28B3.5b.1 | VEP_consequence | synonymous_variant | ||
VEP_impact | LOW | ||||
HGVSc | F28B3.5b.1:c.351C>T | ||||
HGVSp | CE33383:p.Phe117= | ||||
cDNA_position | 449 | ||||
CDS_position | 351 | ||||
Protein_position | 117 | ||||
Exon_number | 4/7 | ||||
Codon_change | ttC/ttT | ||||
Amino_acid_change | F | ||||
F28B3.5a.1 | VEP_consequence | synonymous_variant | |||
VEP_impact | LOW | ||||
HGVSc | F28B3.5a.1:c.351C>T | ||||
HGVSp | CE28826:p.Phe117= | ||||
cDNA_position | 437 | ||||
CDS_position | 351 | ||||
Protein_position | 117 | ||||
Exon_number | 4/8 | ||||
Codon_change | ttC/ttT | ||||
Amino_acid_change | F | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |