WormBase Tree Display for Variation: WBVar00276942
expand all nodes | collapse all nodes | view schema
WBVar00276942 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk1390 | |||
Other_name | K09F6.6.1:c.933C>T | ||||
CE52048:p.Asp311= | |||||
HGVSg | CHROMOSOME_II:g.2277929G>A | ||||
Sequence_details | SMap | S_parent | Sequence | K09F6 | |
Flanking_sequences | CAAAATCATCCTCTGAAGAAGCGACAACAG | TCTTGCCTCTTGCAATTTGGAGTGAGCATT | |||
Mapping_target | K09F6 | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00036969 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00019589 | |||
Transcript | K09F6.6.1 | VEP_consequence | synonymous_variant | ||
VEP_impact | LOW | ||||
HGVSc | K09F6.6.1:c.933C>T | ||||
HGVSp | CE52048:p.Asp311= | ||||
cDNA_position | 1092 | ||||
CDS_position | 933 | ||||
Protein_position | 311 | ||||
Exon_number | 8/14 | ||||
Codon_change | gaC/gaT | ||||
Amino_acid_change | D | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |