WormBase Tree Display for Variation: WBVar00277442

WBVar00277442 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk2747
    Other_name: W05F2.5:n.530A>T
    HGVSg: CHROMOSOME_I:g.3373150A>T
  Sequence_details: SMap: S_parent: Sequence: W05F2
    Flanking_sequences: ACATTTTGACACTTGCGTGAGCTTTGAGCA CGATCTGGATCAATCGATGGTGAAGATTTT
    Mapping_target: W05F2
    Type_of_mutation: Substitution: A T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00005866
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00021037
    Pseudogene: W05F2.5 VEP_consequence: non_coding_transcript_exon_variant
        VEP_impact: MODIFIER
        HGVSc: W05F2.5:n.530A>T
        cDNA_position: 530
        Exon_number: 3/4
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele