WormBase Tree Display for Variation: WBVar00317412

WBVar00317412 Evidence: Paper_evidence: WBPaper00037833
  Name: Public_name: bp251
    Other_name: Y106G6A.2c.1:c.510G>A
      Y106G6A.2d.1:c.279G>A
      CE47002:p.Trp170Ter
      CE30567:p.Trp251Ter
      CE47053:p.Trp93Ter
      Y106G6A.2a.1:c.753G>A
    HGVSg: CHROMOSOME_I:g.9933135C>T
  Sequence_details: SMap: S_parent: Sequence: Y106G6A
    Flanking_sequences: gactgtgaaatcgaaaaactcgaaaaattg gcagttgtgaacgattcagagctgcagaag
    Mapping_target: Y106G6A
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00037833
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00008603
      WBStrain00056343
    Laboratory: HZ
      ZHY
    Status: Live
  Affects: Gene: WBGene00013695
    Transcript: Y106G6A.2a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: Y106G6A.2a.1:c.753G>A
        HGVSp: CE30567:p.Trp251Ter
        cDNA_position: 794
        CDS_position: 753
        Protein_position: 251
        Exon_number: 5/8
        Codon_change: tgG/tgA
        Amino_acid_change: W/*
      Y106G6A.2d.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: Y106G6A.2d.1:c.279G>A
        HGVSp: CE47053:p.Trp93Ter
        cDNA_position: 279
        CDS_position: 279
        Protein_position: 93
        Exon_number: 1/3
        Codon_change: tgG/tgA
        Amino_acid_change: W/*
      Y106G6A.2c.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: Y106G6A.2c.1:c.510G>A
        HGVSp: CE47002:p.Trp170Ter
        cDNA_position: 510
        CDS_position: 510
        Protein_position: 170
        Exon_number: 2/4
        Codon_change: tgG/tgA
        Amino_acid_change: W/*
    Interactor: WBInteraction000504611
      WBInteraction000504613
      WBInteraction000520090
      WBInteraction000525231
      WBInteraction000525255
  Genetics: Interpolated_map_position: I 4.07077
  Description: Phenotype: WBPhenotype:0000067 Paper_evidence: WBPaper00042320
        Curator_confirmed: WBPerson712
        Remark: A few ALG-1 and ALG-2 aggregates were formed in autophagy mutants but the number of aggregates dramatically increased under certain stress conditions, unlike in Wild type controls. Paper_evidence: WBPaper00042320
            Curator_confirmed: WBPerson712
      WBPhenotype:0000119 Paper_evidence: WBPaper00042320
        Curator_confirmed: WBPerson712
        Remark: Levels of endogenous AIN-1 protein, but not ain-1 mRNA, were increased in autophagy mutants. Paper_evidence: WBPaper00042320
            Curator_confirmed: WBPerson712
      WBPhenotype:0000885 Paper_evidence: WBPaper00041694
        Curator_confirmed: WBPerson2798
        Remark: delayed engulfment of apoptotic corpses during embryogenesis Paper_evidence: WBPaper00041694
            Curator_confirmed: WBPerson2798
      WBPhenotype:0000961 Paper_evidence: WBPaper00042320
        Curator_confirmed: WBPerson712
        Remark: In wild-type embryos, AIN-1::GFP was diffusely expressed in the cytoplasm during embryogenesis. In autophagy mutants AIN-1::GFP was strongly expressed and accumulated into a large number of aggregates. Expression of AIN-2::GFP, which is diffusely localized in wild-type embryos, was unaffected in autophagy mutant embryos. Translational fusion reporters for gfp::alg-1 and alg-2::gfp were both diffusely expressed in the cytoplasm of most embryonic cells. Paper_evidence: WBPaper00042320
            Curator_confirmed: WBPerson712
      WBPhenotype:0001181 Paper_evidence: WBPaper00044390
        Curator_confirmed: WBPerson2987
        Remark: The epg-8(bp251) mutation resulted in a significant increase in the number of cell corpses observed in embryos (Table 1, Figure S1A,B) Paper_evidence: WBPaper00044390
            Curator_confirmed: WBPerson2987
      WBPhenotype:0002349 Paper_evidence: WBPaper00044390
        Curator_confirmed: WBPerson2987
        Remark: Authors found significantly reduced YFP-2xFYVE labeling of cell corpses in epg-8(bp251) mutants, suggesting that phosphatidylinositol 3-phosphate (PtdIns3P) generation and/or accumulation on phagosomes is affected (Figure S2C). Paper_evidence: WBPaper00044390
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: YFP-2xFYVE, a marker for phosphatidylinositol 3-phosphate Paper_evidence: WBPaper00044390
              Curator_confirmed: WBPerson2987
    Phenotype_not_observed: WBPhenotype:0000114 Paper_evidence: WBPaper00042320
        Curator_confirmed: WBPerson712
        Remark: Mutants exhibited normal alg-1 and alg-2 and mRNA levels. Paper_evidence: WBPaper00042320
            Curator_confirmed: WBPerson712
      WBPhenotype:0000701 Paper_evidence: WBPaper00042320
        Curator_confirmed: WBPerson712
        Remark: mutants exhibited normal seam cell development Paper_evidence: WBPaper00042320
            Curator_confirmed: WBPerson712
  Reference: WBPaper00041694
    WBPaper00037833
    WBPaper00042320
    WBPaper00044390
    WBPaper00065267
    WBPaper00065712
  Method: Substitution_allele