WormBase Tree Display for Variation: WBVar00597541

WBVar00597541 Name: Public_name: tm5246
    Other_name: Y38C1AA.13.1:c.136-18_*165del
    HGVSg: CHROMOSOME_IV:g.204911_205246del
  Sequence_details: SMap: S_parent: Sequence: Y38C1AA
    Flanking_sequences: CTTGATTGTGAGCGATTTTTTCTGCAAAGC AAATCTACTATATTATTCTGCAGATGGGAG
    Mapping_target: Y38C1AA
    Type_of_mutation: Deletion
    PCR_product: tm5246_external
      tm5246_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5246
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00044736
    Transcript: Y38C1AA.13.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y38C1AA.13.1:c.136-18_*165del
        cDNA_position: ?-733
        Intron_number: 2/3
        Exon_number: 3-4/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 57973/57974-58309/58310 (336 bp deletion)
    This knockout was generated by the National BioResource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. PMID 23173093 Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele