WormBase Tree Display for Variation: WBVar00600816
expand all nodes | collapse all nodes | view schema
WBVar00600816 | Name | Public_name | tm5415 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T03F1.5.2:c.-11+32_315del | |||||||
T03F1.5.1:c.-16+32_315del | ||||||||
HGVSg | CHROMOSOME_I:g.3839117_3839571del | |||||||
Sequence_details | SMap | S_parent | Sequence | T03F1 | ||||
Flanking_sequences | gttctccggatacttgatcttgaagcagaa | tcacatttcgcaacgaaaccctgaaacata | ||||||
Mapping_target | T03F1 | |||||||
Source_location | 7 | CHROMOSOME_I | 3839116 | 3839572 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm5415_external | |||||||
tm5415_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 5415 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00020187 | ||||||
Transcript | T03F1.5.3 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | |||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-332 | |||||||
CDS_position | ?-315 | |||||||
Protein_position | ?-105 | |||||||
Exon_number | 1-2/5 | |||||||
T03F1.5.2 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T03F1.5.2:c.-11+32_315del | |||||||
cDNA_position | ?-376 | |||||||
CDS_position | ?-315 | |||||||
Protein_position | ?-105 | |||||||
Intron_number | 1/5 | |||||||
Exon_number | 2-3/6 | |||||||
T03F1.5.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T03F1.5.1:c.-16+32_315del | |||||||
cDNA_position | ?-401 | |||||||
CDS_position | ?-315 | |||||||
Protein_position | ?-105 | |||||||
Intron_number | 1/5 | |||||||
Exon_number | 2-3/6 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0002421 | Paper_evidence | WBPaper00049736 | ||||
Curator_confirmed | WBPerson1185 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Reference | WBPaper00049736 | |||||||
Remark (2) | ||||||||
Method | NBP_knockout_allele |