WormBase Tree Display for Variation: WBVar00601023
expand all nodes | collapse all nodes | view schema
WBVar00601023 | Evidence | Paper_evidence | WBPaper00031592 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | hp369 | |||||
Other_name | CE47428:p.Arg649Ter | ||||||
F25C8.3a.1:c.1945C>T | |||||||
F25C8.3d.1:c.1945C>T | |||||||
F25C8.3e.1:c.1945C>T | |||||||
CE41563:p.Arg649Ter | |||||||
F25C8.3c.1:c.1891C>T | |||||||
F25C8.3b.1:c.1945C>T | |||||||
CE47217:p.Arg631Ter | |||||||
CE47117:p.Arg649Ter | |||||||
CE43592:p.Arg649Ter | |||||||
HGVSg | CHROMOSOME_V:g.20885654C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | F25C8 | |||
Flanking_sequences | cttgcaccccatcctactacaaattctcga | gaagttcacttaatacgctatcacgacggg | |||||
Mapping_target | F25C8 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00031592 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | ZM | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006812 | |||||
Transcript | F25C8.3d.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | F25C8.3d.1:c.1945C>T | ||||||
HGVSp | CE43592:p.Arg649Ter | ||||||
cDNA_position | 1945 | ||||||
CDS_position | 1945 | ||||||
Protein_position | 649 | ||||||
Exon_number | 10/37 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
F25C8.3b.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | F25C8.3b.1:c.1945C>T | ||||||
HGVSp | CE47117:p.Arg649Ter | ||||||
cDNA_position | 2198 | ||||||
CDS_position | 1945 | ||||||
Protein_position | 649 | ||||||
Exon_number | 11/36 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
F25C8.3e.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | F25C8.3e.1:c.1945C>T | ||||||
HGVSp | CE47428:p.Arg649Ter | ||||||
cDNA_position | 1945 | ||||||
CDS_position | 1945 | ||||||
Protein_position | 649 | ||||||
Exon_number | 10/34 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
F25C8.3c.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | F25C8.3c.1:c.1891C>T | ||||||
HGVSp | CE47217:p.Arg631Ter | ||||||
cDNA_position | 1891 | ||||||
CDS_position | 1891 | ||||||
Protein_position | 631 | ||||||
Exon_number | 10/35 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
F25C8.3a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | F25C8.3a.1:c.1945C>T | ||||||
HGVSp | CE41563:p.Arg649Ter | ||||||
cDNA_position | 1945 | ||||||
CDS_position | 1945 | ||||||
Protein_position | 649 | ||||||
Exon_number | 10/37 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
Genetics | Interpolated_map_position | V | 25.5735 | ||||
Description | Phenotype | WBPhenotype:0001592 | Paper_evidence | WBPaper00031592 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals exhibit recessive and fully penetrant fainter phenotypes identical to that of the nca(lf) double mutant. | Paper_evidence | WBPaper00031592 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive (2) | |||||||
Reference | WBPaper00031592 | ||||||
Method | Substitution_allele |