WormBase Tree Display for Variation: WBVar02121086
expand all nodes | collapse all nodes | view schema
WBVar02121086 | Name | Public_name | WBVar02121086 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00852009 | |||||||
Sequence_details | SMap | S_parent | Sequence | Y39G10AR | ||||
Flanking_sequences | TTTGAAAATTATCGGTCTTTTTAACTTATC | TCGAAAAATCAATATCGTTCTCGAAAAAAT | ||||||
Mapping_target | Y39G10AR | |||||||
Source_location | 225 | CHROMOSOME_I | 2336001 | 2364000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004602 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00021464 | ||||||
WBGene00021461 | ||||||||
WBGene00077563 | ||||||||
WBGene00044277 | ||||||||
WBGene00021463 | ||||||||
Transcript | Y39G10AR.3a.1 | |||||||
Y39G10AR.25.1 | ||||||||
Y39G10AR.3b.1 | ||||||||
Y39G10AR.6.1 | ||||||||
Y39G10AR.25.2 | ||||||||
Y39G10AR.5.1 | ||||||||
Pseudogene | Y39G10AR.23 | |||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |