WormBase Tree Display for Variation: WBVar02122052
expand all nodes | collapse all nodes | view schema
WBVar02122052 | Name (2) | |||||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_X | ||||
Flanking_sequences | TCATCGTTTGATGATTTCTTTTTGATCCCA | TTTTTACATACGCCAAATTTAACGCTGCAA | ||||||
Mapping_target | CHROMOSOME_X | |||||||
Source_location | 225 | CHROMOSOME_X | 3556001 | 3575000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin (5) | ||||||||
Affects | Gene | WBGene00006928 | ||||||
WBGene00020845 | ||||||||
WBGene00197773 | ||||||||
WBGene00006927 | ||||||||
WBGene00196684 | ||||||||
WBGene00004350 | ||||||||
Transcript (14) | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |