WormBase Tree Display for Variation: WBVar02122994
expand all nodes | collapse all nodes | view schema
WBVar02122994 | Name | Public_name | WBVar02122994 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00853917 | |||||||
Sequence_details | SMap | S_parent | Sequence | Y110A7A | ||||
Flanking_sequences | AAACTTAAAAGAAGGATTGAAACAAGATAA | GATTCTGGTCAAGAGCAAAGCACATTCTGA | ||||||
Mapping_target | Y110A7A | |||||||
Source_location | 225 | CHROMOSOME_I | 5144001 | 5163000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023286 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006797 | ||||||
WBGene00004094 | ||||||||
WBGene00002804 | ||||||||
WBGene00022454 | ||||||||
Transcript | Y110A7A.3.1 | |||||||
Y110A7A.19.1 | ||||||||
Y110A7A.18.1 | ||||||||
Y110A7A.2.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |