WormBase Tree Display for Variation: WBVar02125477

WBVar02125477 Name: Public_name: tm6645
    Other_name: CE17113:p.Val40GlnfsTer10
      F55A3.3.1:c.118_599delinsCAAATCACTTGCTCTTGC
    HGVSg: CHROMOSOME_I:g.10789302_10789833delinsCAAATCACTTGCTCTTGC
  Sequence_details: SMap: S_parent: Sequence: F55A3
    Flanking_sequences: tcaaatattttacaggagaagggagccgatggtctagattcgatcaaatcacttgctttt agagatcattgatcaagaaaaggtgcttat
    Mapping_target: F55A3
    Source_location: 7 CHROMOSOME_I 10789301 10789834 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CAAATCACTTGCTCTTGC
      Deletion
    PCR_product: tm6645_external
      tm6645_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6645
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00018849
    Transcript: F55A3.3.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 14587/14588-CAAATCACTTGCTCTTGC-15119/15120 (532 bp deletion + 18 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele