WormBase Tree Display for Variation: WBVar02125477
expand all nodes | collapse all nodes | view schema
WBVar02125477 | Name | Public_name | tm6645 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE17113:p.Val40GlnfsTer10 | |||||||
F55A3.3.1:c.118_599delinsCAAATCACTTGCTCTTGC | ||||||||
HGVSg | CHROMOSOME_I:g.10789302_10789833delinsCAAATCACTTGCTCTTGC | |||||||
Sequence_details | SMap | S_parent | Sequence | F55A3 | ||||
Flanking_sequences | tcaaatattttacaggagaagggagccgatggtctagattcgatcaaatcacttgctttt | agagatcattgatcaagaaaaggtgcttat | ||||||
Mapping_target | F55A3 | |||||||
Source_location | 7 | CHROMOSOME_I | 10789301 | 10789834 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | CAAATCACTTGCTCTTGC | ||||||
Deletion | ||||||||
PCR_product | tm6645_external | |||||||
tm6645_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 6645 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00018849 | ||||||
Transcript | F55A3.3.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal or sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal or sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Remark | 14587/14588-CAAATCACTTGCTCTTGC-15119/15120 (532 bp deletion + 18 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |