WormBase Tree Display for Variation: WBVar02141097

WBVar02141097 Name: Public_name: tm6839
    Other_name: CE27647:p.Ser62PhefsTer24
      C04C3.3.1:c.185_280delinsT
    HGVSg: CHROMOSOME_IV:g.3400002_3400632delinsT
  Sequence_details: SMap: S_parent: Sequence: C04C3
    Flanking_sequences: ttgctcagtacgacggagcttacaagattt ccgggctccgtccaatttgcgagttcatga
    Mapping_target: C04C3
    Source_location: 7 CHROMOSOME_IV 3400001 3400633 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: T
      Deletion
    PCR_product: tm6839_external
      tm6839_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6839
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00015413
    Transcript: C04C3.3.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 10010/10011-T-10641/10642 (631 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele