WormBase Tree Display for Variation: WBVar02144846
expand all nodes | collapse all nodes | view schema
| WBVar02144846 | Evidence | Paper_evidence | WBPaper00047026 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | tr411 | |||||
| Other_name | CE01579:p.Ile260Asn | ||||||
| F42A8.2.1:c.779T>A | |||||||
| HGVSg | CHROMOSOME_II:g.9351037A>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | F42A8 | |||
| Flanking_sequences | acttttgggcatgtctttgtgcaattcatg | tggtgtggcacttgaaagctgagaaagagt | |||||
| Mapping_target | F42A8 | ||||||
| Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00033451 | ||||||
| Laboratory | RP | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006433 | |||||
| Transcript | F42A8.2.1 (12) | ||||||
| Genetics | Interpolated_map_position | II | 1.29075 | ||||
| Description | Phenotype | WBPhenotype:0000011 | Paper_evidence | WBPaper00047026 | |||
| Curator_confirmed | WBPerson14226 | ||||||
| Remark | Animals are resistant to the growth defects induced by the mitochondrial complex II inhibitor wact-11. | Paper_evidence | WBPaper00047026 | ||||
| Curator_confirmed | WBPerson14226 | ||||||
| Phenotype_not_observed | WBPhenotype:0000031 | Paper_evidence | WBPaper00047026 | ||||
| Curator_confirmed | WBPerson14226 | ||||||
| Reference | WBPaper00047026 | ||||||
| Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
| [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
| Method | Substitution_allele |
