WormBase Tree Display for Variation: WBVar02144846
expand all nodes | collapse all nodes | view schema
WBVar02144846 | Evidence | Paper_evidence | WBPaper00047026 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | tr411 | |||||
Other_name | CE01579:p.Ile260Asn | ||||||
F42A8.2.1:c.779T>A | |||||||
HGVSg | CHROMOSOME_II:g.9351037A>T | ||||||
Sequence_details | SMap | S_parent | Sequence | F42A8 | |||
Flanking_sequences | acttttgggcatgtctttgtgcaattcatg | tggtgtggcacttgaaagctgagaaagagt | |||||
Mapping_target | F42A8 | ||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00033451 | ||||||
Laboratory | RP | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006433 | |||||
Transcript | F42A8.2.1 (12) | ||||||
Genetics | Interpolated_map_position | II | 1.29075 | ||||
Description | Phenotype | WBPhenotype:0000011 | Paper_evidence | WBPaper00047026 | |||
Curator_confirmed | WBPerson14226 | ||||||
Remark | Animals are resistant to the growth defects induced by the mitochondrial complex II inhibitor wact-11. | Paper_evidence | WBPaper00047026 | ||||
Curator_confirmed | WBPerson14226 | ||||||
Phenotype_not_observed | WBPhenotype:0000031 | Paper_evidence | WBPaper00047026 | ||||
Curator_confirmed | WBPerson14226 | ||||||
Reference | WBPaper00047026 | ||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |