WormBase Tree Display for Variation: WBVar02146654

WBVar02146654 Name: Public_name: tm8373
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_II
    Flanking_sequences: gcacacctttcgacattcaaaaaacatttt gttatgtgcttcaaaacggagctgttaagc
    Mapping_target: CHROMOSOME_II
    Source_location: 7 CHROMOSOME_II 9336723 9365101 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm8373_external
      tm8373_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 8373
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006433
      WBGene00009626
      WBGene00219945
      WBGene00008405
      WBGene00004744
      WBGene00003196
      WBGene00009627
    Transcript (15)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: [D2013]37114/37115-[C06C3]3256/3257 (28378 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target D2013 updated based on the VEP analysis pipeline to CHROMOSOME_II.
  Method: NBP_knockout_allele