WormBase Tree Display for Variation: WBVar02147403
expand all nodes | collapse all nodes | view schema
| WBVar02147403 | Evidence | Paper_evidence | WBPaper00049350 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | xr58 | |||||||
| Other_name | CE17653:p.Pro440Ser | ||||||||
| F11A6.1a.2:c.1318C>T | |||||||||
| F11A6.1a.1:c.1318C>T | |||||||||
| HGVSg | CHROMOSOME_I:g.11679198C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F11A6 | |||||
| Flanking_sequences | aatatgcacacggggaccagtgcaagtgct | cgttggctgctggaattgttgctcttgctc | |||||||
| Mapping_target | F11A6 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00049350 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | TV | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00002232 | |||||||
| Transcript | F11A6.1a.1 | VEP_consequence | missense_variant | ||||||
| VEP_impact | MODERATE | ||||||||
| HGVSc | F11A6.1a.1:c.1318C>T | ||||||||
| HGVSp | CE17653:p.Pro440Ser | ||||||||
| cDNA_position | 1418 | ||||||||
| CDS_position | 1318 | ||||||||
| Protein_position | 440 | ||||||||
| Exon_number | 5/9 | ||||||||
| Codon_change | Ccg/Tcg | ||||||||
| Amino_acid_change | P/S | ||||||||
| F11A6.1a.2 | VEP_consequence | missense_variant | |||||||
| VEP_impact | MODERATE | ||||||||
| HGVSc | F11A6.1a.2:c.1318C>T | ||||||||
| HGVSp | CE17653:p.Pro440Ser | ||||||||
| cDNA_position | 1422 | ||||||||
| CDS_position | 1318 | ||||||||
| Protein_position | 440 | ||||||||
| Exon_number | 5/9 | ||||||||
| Codon_change | Ccg/Tcg | ||||||||
| Amino_acid_change | P/S | ||||||||
| Genetics | Interpolated_map_position | I | 9.5394 | ||||||
| Description | Phenotype | WBPhenotype:0000882 | Paper_evidence | WBPaper00056964 | |||||
| Curator_confirmed | WBPerson48777 | ||||||||
| Remark | 3° dendrites that fail to self-avoid and overgrow one another. Fig 9D. | Paper_evidence | WBPaper00056964 | ||||||
| Curator_confirmed | WBPerson48777 | ||||||||
| Penetrance | Incomplete | Paper_evidence | WBPaper00056964 | ||||||
| Curator_confirmed | WBPerson48777 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006831 | PATO:0000460 | Paper_evidence | WBPaper00056964 | ||||
| Curator_confirmed | WBPerson48777 | ||||||||
| Phenotype_assay | Control_strain | WBStrain00047813 | Paper_evidence | WBPaper00056964 | |||||
| Curator_confirmed | WBPerson48777 | ||||||||
| Genotype | wdIs52 (pF49H12.4::GFP) | Paper_evidence | WBPaper00056964 | ||||||
| Curator_confirmed | WBPerson48777 | ||||||||
| Reference | WBPaper00049350 | ||||||||
| WBPaper00056964 | |||||||||
| Method | Substitution_allele |
