WormBase Tree Display for Variation: WBVar02147749

WBVar02147749 Name: Public_name: tm4103
    Other_name: CE00539:p.Ser393_Ter591delextTer?
      B0303.9.1:c.1177_1773del
    HGVSg: CHROMOSOME_III:g.8702446_8703088del
  Sequence_details: SMap: S_parent: Sequence: B0303
    Flanking_sequences: caatcacatgtgtactgtaagcagtcggat actggcgataagcttctgaataatattacc
    Mapping_target: B0303
    Source_location: 7 CHROMOSOME_III 8702445 8703089 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4103_external
      tm4103_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4103
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00015130
    Transcript: B0303.9.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 22231/22232-22874/22875 (643 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele